Incidental Mutation 'R8196:Tmem67'
ID635440
Institutional Source Beutler Lab
Gene Symbol Tmem67
Ensembl Gene ENSMUSG00000049488
Gene Nametransmembrane protein 67
Synonymsb2b1291.1Clo, 5330408M12Rik, b2b1163.1Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8196 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location12039355-12090020 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12075661 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 183 (T183A)
Ref Sequence ENSEMBL: ENSMUSP00000052644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050686] [ENSMUST00000108293]
Predicted Effect probably benign
Transcript: ENSMUST00000050686
AA Change: T183A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052644
Gene: ENSMUSG00000049488
AA Change: T183A

DomainStartEndE-ValueType
low complexity region 17 23 N/A INTRINSIC
Pfam:Meckelin 166 995 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108293
AA Change: T249A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000103928
Gene: ENSMUSG00000049488
AA Change: T249A

DomainStartEndE-ValueType
low complexity region 83 89 N/A INTRINSIC
Pfam:Meckelin 236 1061 N/A PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000115154
Gene: ENSMUSG00000049488
AA Change: T180A

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the primary cilium and to the plasma membrane. The gene functions in centriole migration to the apical membrane and formation of the primary cilium. Multiple transcript variants encoding different isoforms have been found for this gene. Defects in this gene are a cause of Meckel syndrome type 3 (MKS3) and Joubert syndrome type 6 (JBTS6). [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit neonatal/postanal lethality, kidney cysts, and Meckel-Gruber or Joubert syndrome-like phenotypes depending on the filial generation of the backcross to C57BL/6J. Mice homozygous for an ENU-induced allele exhibit cardiovascular defects and cystic kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b T A 19: 21,678,660 V102D probably damaging Het
Adam6b T A 12: 113,490,467 D301E probably benign Het
Adnp A C 2: 168,183,172 D734E probably benign Het
Ank2 T A 3: 126,929,883 T932S probably damaging Het
Arhgap20 C A 9: 51,848,977 D709E possibly damaging Het
Atoh1 A G 6: 64,730,242 D307G probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
B3galt1 A G 2: 68,118,186 I82V probably benign Het
Chd2 T C 7: 73,468,537 D1111G probably benign Het
Csmd1 T C 8: 16,009,468 D2089G probably benign Het
Dach1 T A 14: 98,018,934 H296L probably damaging Het
Dennd4b T G 3: 90,271,597 L556R probably damaging Het
Dopey1 T A 9: 86,523,098 S326T probably benign Het
Eif2b5 T A 16: 20,502,556 H286Q probably damaging Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Fn3k T A 11: 121,450,396 F292L probably damaging Het
Gm1123 G A 9: 99,023,256 A67V probably benign Het
Hey2 C T 10: 30,834,277 C160Y probably benign Het
Jph2 T A 2: 163,338,701 probably null Het
Lars A G 18: 42,210,101 S1084P possibly damaging Het
Macf1 T C 4: 123,382,704 D6084G probably damaging Het
Mdfic G T 6: 15,740,990 A115S probably benign Het
Mki67 T C 7: 135,695,508 E2599G probably damaging Het
Mtus1 A G 8: 41,056,652 S131P probably benign Het
Muc16 G T 9: 18,645,334 T3221K unknown Het
Olfr147 A G 9: 38,403,608 S245G probably damaging Het
Olfr357 T A 2: 36,996,861 I17N possibly damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pdgfc A G 3: 81,037,504 E23G possibly damaging Het
Pfkp T C 13: 6,605,662 T312A probably benign Het
Pxn A G 5: 115,545,709 E200G probably damaging Het
Rai1 C T 11: 60,185,970 H287Y probably damaging Het
Rap1gap G A 4: 137,717,964 V319I probably benign Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Selp A T 1: 164,133,921 D401V possibly damaging Het
Sh3bp5 A G 14: 31,417,442 V58A probably benign Het
Shpk A T 11: 73,203,949 I64F probably benign Het
Slmap A G 14: 26,468,491 Y171H probably damaging Het
Tyw1 G T 5: 130,300,021 L549F probably damaging Het
Uhrf2 T A 19: 30,073,929 M301K probably benign Het
Uvssa G A 5: 33,410,967 V532I probably benign Het
Vmn2r113 A T 17: 22,957,964 K574I probably damaging Het
Zfp52 A G 17: 21,561,894 N668S possibly damaging Het
Other mutations in Tmem67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Tmem67 APN 4 12061826 missense probably damaging 0.98
IGL00768:Tmem67 APN 4 12055029 critical splice donor site probably null
IGL00813:Tmem67 APN 4 12058587 splice site probably benign
IGL01070:Tmem67 APN 4 12054750 missense probably benign 0.20
IGL01088:Tmem67 APN 4 12063126 missense probably damaging 1.00
IGL01353:Tmem67 APN 4 12079895 missense probably damaging 1.00
IGL01490:Tmem67 APN 4 12057422 splice site probably benign
IGL01885:Tmem67 APN 4 12057389 missense probably damaging 1.00
IGL02061:Tmem67 APN 4 12053526 missense probably damaging 1.00
IGL02151:Tmem67 APN 4 12068882 missense probably benign 0.35
IGL02166:Tmem67 APN 4 12047313 missense possibly damaging 0.90
IGL02243:Tmem67 APN 4 12070584 missense possibly damaging 0.93
IGL02517:Tmem67 APN 4 12069463 missense possibly damaging 0.67
IGL02736:Tmem67 APN 4 12045789 splice site probably null
R0282:Tmem67 UTSW 4 12087930 missense probably damaging 0.99
R0514:Tmem67 UTSW 4 12089317 missense probably benign
R1221:Tmem67 UTSW 4 12045871 missense possibly damaging 0.92
R1301:Tmem67 UTSW 4 12089400 unclassified probably benign
R1581:Tmem67 UTSW 4 12047814 missense probably damaging 1.00
R1680:Tmem67 UTSW 4 12087840 missense probably benign 0.00
R1804:Tmem67 UTSW 4 12045789 splice site probably null
R2174:Tmem67 UTSW 4 12063730 nonsense probably null
R2191:Tmem67 UTSW 4 12069413 critical splice donor site probably null
R2246:Tmem67 UTSW 4 12040651 missense probably damaging 1.00
R2566:Tmem67 UTSW 4 12079918 missense probably damaging 0.99
R3409:Tmem67 UTSW 4 12073952 missense probably benign 0.00
R3410:Tmem67 UTSW 4 12073952 missense probably benign 0.00
R4078:Tmem67 UTSW 4 12040633 critical splice donor site probably null
R4282:Tmem67 UTSW 4 12073922 missense probably damaging 0.99
R4429:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4430:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4431:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4734:Tmem67 UTSW 4 12063158 missense probably benign 0.00
R4856:Tmem67 UTSW 4 12089416 unclassified probably benign
R4865:Tmem67 UTSW 4 12070262 missense probably benign 0.01
R5056:Tmem67 UTSW 4 12070471 missense probably benign 0.29
R5575:Tmem67 UTSW 4 12047886 missense possibly damaging 0.93
R5614:Tmem67 UTSW 4 12061755 missense possibly damaging 0.54
R6030:Tmem67 UTSW 4 12063799 missense probably benign 0.01
R6030:Tmem67 UTSW 4 12063799 missense probably benign 0.01
R6182:Tmem67 UTSW 4 12051402 missense probably benign 0.05
R6562:Tmem67 UTSW 4 12053445 critical splice donor site probably null
R6574:Tmem67 UTSW 4 12063086 missense possibly damaging 0.70
R6696:Tmem67 UTSW 4 12061754 critical splice donor site probably null
R6824:Tmem67 UTSW 4 12051449 missense probably damaging 1.00
R7028:Tmem67 UTSW 4 12075484 missense probably benign 0.12
R7174:Tmem67 UTSW 4 12077337 missense possibly damaging 0.82
R7369:Tmem67 UTSW 4 12053535 missense probably damaging 1.00
R7638:Tmem67 UTSW 4 12079883 missense probably benign 0.17
R7671:Tmem67 UTSW 4 12063698 missense probably benign 0.00
R7736:Tmem67 UTSW 4 12053455 missense probably benign 0.09
R7920:Tmem67 UTSW 4 12089284 critical splice donor site probably null
R7981:Tmem67 UTSW 4 12070592 missense probably damaging 1.00
R8005:Tmem67 UTSW 4 12047821 missense probably damaging 1.00
R8086:Tmem67 UTSW 4 12040738 missense probably damaging 1.00
R8344:Tmem67 UTSW 4 12058576 missense probably benign 0.00
R8350:Tmem67 UTSW 4 12087891 missense probably benign 0.07
R8450:Tmem67 UTSW 4 12087891 missense probably benign 0.07
R8899:Tmem67 UTSW 4 12055038 missense probably damaging 0.99
Z1176:Tmem67 UTSW 4 12087983 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAAAATTCCCTGTGTTGCTG -3'
(R):5'- TCATGCTCTCAGCTGACACTG -3'

Sequencing Primer
(F):5'- GTTGCTGAAACATAATCCACCTGTC -3'
(R):5'- TGCTCTCAGCTGACACTGAAGAAG -3'
Posted On2020-07-13