Incidental Mutation 'R8196:Tyw1'
ID635444
Institutional Source Beutler Lab
Gene Symbol Tyw1
Ensembl Gene ENSMUSG00000056310
Gene NametRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
SynonymsRsafd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8196 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location130255619-130341563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 130300021 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 549 (L549F)
Ref Sequence ENSEMBL: ENSMUSP00000037173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040213]
Predicted Effect probably damaging
Transcript: ENSMUST00000040213
AA Change: L549F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037173
Gene: ENSMUSG00000056310
AA Change: L549F

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 1.6e-27 PFAM
low complexity region 276 288 N/A INTRINSIC
Pfam:Radical_SAM 399 581 1.1e-29 PFAM
Pfam:Wyosine_form 583 646 3.6e-29 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Wybutosine (yW) is a hypermodified guanosine found in phenylalanine tRNA adjacent to the anticodon that stabilizes codon-anticodon interactions in the ribosome. In yeast, the homolog of this gene is essential for the synthesis of wybutosine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b T A 19: 21,678,660 V102D probably damaging Het
Adam6b T A 12: 113,490,467 D301E probably benign Het
Adnp A C 2: 168,183,172 D734E probably benign Het
Ank2 T A 3: 126,929,883 T932S probably damaging Het
Arhgap20 C A 9: 51,848,977 D709E possibly damaging Het
Atoh1 A G 6: 64,730,242 D307G probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
B3galt1 A G 2: 68,118,186 I82V probably benign Het
Chd2 T C 7: 73,468,537 D1111G probably benign Het
Csmd1 T C 8: 16,009,468 D2089G probably benign Het
Dach1 T A 14: 98,018,934 H296L probably damaging Het
Dennd4b T G 3: 90,271,597 L556R probably damaging Het
Dopey1 T A 9: 86,523,098 S326T probably benign Het
Eif2b5 T A 16: 20,502,556 H286Q probably damaging Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Fn3k T A 11: 121,450,396 F292L probably damaging Het
Gm1123 G A 9: 99,023,256 A67V probably benign Het
Hey2 C T 10: 30,834,277 C160Y probably benign Het
Jph2 T A 2: 163,338,701 probably null Het
Lars A G 18: 42,210,101 S1084P possibly damaging Het
Macf1 T C 4: 123,382,704 D6084G probably damaging Het
Mdfic G T 6: 15,740,990 A115S probably benign Het
Mki67 T C 7: 135,695,508 E2599G probably damaging Het
Mtus1 A G 8: 41,056,652 S131P probably benign Het
Muc16 G T 9: 18,645,334 T3221K unknown Het
Olfr147 A G 9: 38,403,608 S245G probably damaging Het
Olfr357 T A 2: 36,996,861 I17N possibly damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pdgfc A G 3: 81,037,504 E23G possibly damaging Het
Pfkp T C 13: 6,605,662 T312A probably benign Het
Pxn A G 5: 115,545,709 E200G probably damaging Het
Rai1 C T 11: 60,185,970 H287Y probably damaging Het
Rap1gap G A 4: 137,717,964 V319I probably benign Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Selp A T 1: 164,133,921 D401V possibly damaging Het
Sh3bp5 A G 14: 31,417,442 V58A probably benign Het
Shpk A T 11: 73,203,949 I64F probably benign Het
Slmap A G 14: 26,468,491 Y171H probably damaging Het
Tmem67 T C 4: 12,075,661 T183A probably benign Het
Uhrf2 T A 19: 30,073,929 M301K probably benign Het
Uvssa G A 5: 33,410,967 V532I probably benign Het
Vmn2r113 A T 17: 22,957,964 K574I probably damaging Het
Zfp52 A G 17: 21,561,894 N668S possibly damaging Het
Other mutations in Tyw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02329:Tyw1 APN 5 130267080 missense probably benign 0.20
IGL02873:Tyw1 APN 5 130335330 missense probably benign 0.00
IGL02879:Tyw1 APN 5 130296771 missense probably damaging 1.00
IGL03080:Tyw1 APN 5 130267055 missense probably damaging 1.00
IGL03291:Tyw1 APN 5 130299993 missense probably damaging 1.00
IGL03297:Tyw1 APN 5 130340734 missense probably damaging 1.00
R1420:Tyw1 UTSW 5 130274745 critical splice donor site probably null
R1650:Tyw1 UTSW 5 130288911 missense possibly damaging 0.91
R1674:Tyw1 UTSW 5 130269328 missense probably benign 0.01
R1789:Tyw1 UTSW 5 130258993 missense probably damaging 0.99
R1996:Tyw1 UTSW 5 130262811 splice site probably benign
R2421:Tyw1 UTSW 5 130269260 missense probably damaging 1.00
R3913:Tyw1 UTSW 5 130259035 missense probably damaging 0.98
R4412:Tyw1 UTSW 5 130335232 splice site probably null
R4835:Tyw1 UTSW 5 130277058 missense probably benign
R5058:Tyw1 UTSW 5 130277086 missense probably benign 0.03
R5190:Tyw1 UTSW 5 130267915 nonsense probably null
R5398:Tyw1 UTSW 5 130277157 intron probably benign
R5459:Tyw1 UTSW 5 130274706 missense probably damaging 1.00
R5597:Tyw1 UTSW 5 130274657 missense probably benign 0.00
R5704:Tyw1 UTSW 5 130282022 nonsense probably null
R5825:Tyw1 UTSW 5 130268088 missense probably damaging 0.99
R5887:Tyw1 UTSW 5 130325699 missense probably damaging 1.00
R6072:Tyw1 UTSW 5 130267911 missense possibly damaging 0.92
R6349:Tyw1 UTSW 5 130277031 missense possibly damaging 0.82
R6366:Tyw1 UTSW 5 130281951 unclassified probably benign
R7012:Tyw1 UTSW 5 130277730 splice site probably null
R7259:Tyw1 UTSW 5 130267872 splice site probably null
R7328:Tyw1 UTSW 5 130262844 missense probably benign 0.08
R7555:Tyw1 UTSW 5 130274706 missense probably damaging 1.00
R8006:Tyw1 UTSW 5 130268072 missense possibly damaging 0.87
R8171:Tyw1 UTSW 5 130300014 missense probably benign 0.19
R8714:Tyw1 UTSW 5 130269224 missense probably damaging 1.00
R8715:Tyw1 UTSW 5 130269224 missense probably damaging 1.00
R8716:Tyw1 UTSW 5 130269224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATACGGTGGAATTCCTGAC -3'
(R):5'- TAGTAGGCATGCACACAGTAC -3'

Sequencing Primer
(F):5'- GGAATTCCTGACGTAGGCATC -3'
(R):5'- GTAGGCATGCACACAGTACACATG -3'
Posted On2020-07-13