Incidental Mutation 'R8196:Atoh1'
ID635446
Institutional Source Beutler Lab
Gene Symbol Atoh1
Ensembl Gene ENSMUSG00000073043
Gene Nameatonal bHLH transcription factor 1
SynonymsbHLHa14, Hath1, Math1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8196 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location64729125-64731245 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64730242 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 307 (D307G)
Ref Sequence ENSEMBL: ENSMUSP00000098903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101351]
Predicted Effect probably benign
Transcript: ENSMUST00000101351
AA Change: D307G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000098903
Gene: ENSMUSG00000073043
AA Change: D307G

DomainStartEndE-ValueType
low complexity region 19 41 N/A INTRINSIC
HLH 162 214 1.1e-20 SMART
low complexity region 243 268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the basic helix-loop-helix (BHLH) family of transcription factors. It activates E-box dependent transcription along with E47. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a decreased cerebellum without folia, and lack cerebellar granule neurons, inner-ear hair cells, D1 interneurons, and goblet, enteroendocrine, and Paneth cells. Mutants fail to breathe properly and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b T A 19: 21,678,660 V102D probably damaging Het
Adam6b T A 12: 113,490,467 D301E probably benign Het
Adnp A C 2: 168,183,172 D734E probably benign Het
Ank2 T A 3: 126,929,883 T932S probably damaging Het
Arhgap20 C A 9: 51,848,977 D709E possibly damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
B3galt1 A G 2: 68,118,186 I82V probably benign Het
Chd2 T C 7: 73,468,537 D1111G probably benign Het
Csmd1 T C 8: 16,009,468 D2089G probably benign Het
Dach1 T A 14: 98,018,934 H296L probably damaging Het
Dennd4b T G 3: 90,271,597 L556R probably damaging Het
Dopey1 T A 9: 86,523,098 S326T probably benign Het
Eif2b5 T A 16: 20,502,556 H286Q probably damaging Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Fn3k T A 11: 121,450,396 F292L probably damaging Het
Gm1123 G A 9: 99,023,256 A67V probably benign Het
Hey2 C T 10: 30,834,277 C160Y probably benign Het
Jph2 T A 2: 163,338,701 probably null Het
Lars A G 18: 42,210,101 S1084P possibly damaging Het
Macf1 T C 4: 123,382,704 D6084G probably damaging Het
Mdfic G T 6: 15,740,990 A115S probably benign Het
Mki67 T C 7: 135,695,508 E2599G probably damaging Het
Mtus1 A G 8: 41,056,652 S131P probably benign Het
Muc16 G T 9: 18,645,334 T3221K unknown Het
Olfr147 A G 9: 38,403,608 S245G probably damaging Het
Olfr357 T A 2: 36,996,861 I17N possibly damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pdgfc A G 3: 81,037,504 E23G possibly damaging Het
Pfkp T C 13: 6,605,662 T312A probably benign Het
Pxn A G 5: 115,545,709 E200G probably damaging Het
Rai1 C T 11: 60,185,970 H287Y probably damaging Het
Rap1gap G A 4: 137,717,964 V319I probably benign Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Selp A T 1: 164,133,921 D401V possibly damaging Het
Sh3bp5 A G 14: 31,417,442 V58A probably benign Het
Shpk A T 11: 73,203,949 I64F probably benign Het
Slmap A G 14: 26,468,491 Y171H probably damaging Het
Tmem67 T C 4: 12,075,661 T183A probably benign Het
Tyw1 G T 5: 130,300,021 L549F probably damaging Het
Uhrf2 T A 19: 30,073,929 M301K probably benign Het
Vmn2r113 A T 17: 22,957,964 K574I probably damaging Het
Zfp52 A G 17: 21,561,894 N668S possibly damaging Het
Other mutations in Atoh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Atoh1 APN 6 64729584 missense possibly damaging 0.54
IGL02126:Atoh1 APN 6 64729350 missense probably damaging 1.00
R1354:Atoh1 UTSW 6 64729357 missense possibly damaging 0.53
R1674:Atoh1 UTSW 6 64729930 missense possibly damaging 0.88
R1675:Atoh1 UTSW 6 64730157 missense probably benign 0.01
R1895:Atoh1 UTSW 6 64729459 missense probably benign 0.01
R1946:Atoh1 UTSW 6 64729459 missense probably benign 0.01
R1988:Atoh1 UTSW 6 64729633 missense probably benign 0.04
R2566:Atoh1 UTSW 6 64729684 missense probably damaging 1.00
R3730:Atoh1 UTSW 6 64729573 missense probably benign 0.00
R3893:Atoh1 UTSW 6 64730133 missense probably damaging 1.00
R4241:Atoh1 UTSW 6 64729774 missense probably damaging 1.00
R7411:Atoh1 UTSW 6 64729930 missense probably damaging 1.00
R7749:Atoh1 UTSW 6 64729920 missense possibly damaging 0.89
R8289:Atoh1 UTSW 6 64729909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACGCTCTGTCGGAGTTG -3'
(R):5'- TGTCTCAGTTTTCAGGGAGC -3'

Sequencing Primer
(F):5'- AGTTGCTGCAGACTCCCAATG -3'
(R):5'- GGGAGCTGTTGCCTTCCTAAC -3'
Posted On2020-07-13