Incidental Mutation 'R8196:Olfr921'
ID635453
Institutional Source Beutler Lab
Gene Symbol Olfr921
Ensembl Gene ENSMUSG00000049926
Gene Nameolfactory receptor 921
SynonymsMOR165-8, GA_x6K02T2PVTD-32478047-32478988
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8196 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38773068-38779021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38775281 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 9 (V9M)
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000062124
AA Change: V9M
SMART Domains Protein: ENSMUSP00000051879
Gene: ENSMUSG00000049926
AA Change: V9M

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-48 PFAM
Pfam:7tm_1 41 290 6.3e-23 PFAM
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b T A 19: 21,678,660 V102D probably damaging Het
Adam6b T A 12: 113,490,467 D301E probably benign Het
Adnp A C 2: 168,183,172 D734E probably benign Het
Ank2 T A 3: 126,929,883 T932S probably damaging Het
Arhgap20 C A 9: 51,848,977 D709E possibly damaging Het
Atoh1 A G 6: 64,730,242 D307G probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
B3galt1 A G 2: 68,118,186 I82V probably benign Het
Chd2 T C 7: 73,468,537 D1111G probably benign Het
Csmd1 T C 8: 16,009,468 D2089G probably benign Het
Dach1 T A 14: 98,018,934 H296L probably damaging Het
Dennd4b T G 3: 90,271,597 L556R probably damaging Het
Dopey1 T A 9: 86,523,098 S326T probably benign Het
Eif2b5 T A 16: 20,502,556 H286Q probably damaging Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Fn3k T A 11: 121,450,396 F292L probably damaging Het
Gm1123 G A 9: 99,023,256 A67V probably benign Het
Hey2 C T 10: 30,834,277 C160Y probably benign Het
Jph2 T A 2: 163,338,701 probably null Het
Lars A G 18: 42,210,101 S1084P possibly damaging Het
Macf1 T C 4: 123,382,704 D6084G probably damaging Het
Mdfic G T 6: 15,740,990 A115S probably benign Het
Mki67 T C 7: 135,695,508 E2599G probably damaging Het
Mtus1 A G 8: 41,056,652 S131P probably benign Het
Muc16 G T 9: 18,645,334 T3221K unknown Het
Olfr147 A G 9: 38,403,608 S245G probably damaging Het
Olfr357 T A 2: 36,996,861 I17N possibly damaging Het
Pdgfc A G 3: 81,037,504 E23G possibly damaging Het
Pfkp T C 13: 6,605,662 T312A probably benign Het
Pxn A G 5: 115,545,709 E200G probably damaging Het
Rai1 C T 11: 60,185,970 H287Y probably damaging Het
Rap1gap G A 4: 137,717,964 V319I probably benign Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Selp A T 1: 164,133,921 D401V possibly damaging Het
Sh3bp5 A G 14: 31,417,442 V58A probably benign Het
Shpk A T 11: 73,203,949 I64F probably benign Het
Slmap A G 14: 26,468,491 Y171H probably damaging Het
Tmem67 T C 4: 12,075,661 T183A probably benign Het
Tyw1 G T 5: 130,300,021 L549F probably damaging Het
Uhrf2 T A 19: 30,073,929 M301K probably benign Het
Uvssa G A 5: 33,410,967 V532I probably benign Het
Vmn2r113 A T 17: 22,957,964 K574I probably damaging Het
Zfp52 A G 17: 21,561,894 N668S possibly damaging Het
Other mutations in Olfr921
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Olfr921 APN 9 38775812 nonsense probably null
IGL01016:Olfr921 APN 9 38775441 missense probably damaging 0.99
IGL01391:Olfr921 APN 9 38775530 missense probably damaging 1.00
IGL01451:Olfr921 APN 9 38775929 missense probably benign 0.04
IGL02250:Olfr921 APN 9 38775554 missense probably damaging 1.00
R0026:Olfr921 UTSW 9 38775596 missense probably benign 0.01
R0334:Olfr921 UTSW 9 38775239 critical splice acceptor site probably null
R0655:Olfr921 UTSW 9 38775554 nonsense probably null
R1024:Olfr921 UTSW 9 38775335 missense probably damaging 0.97
R3522:Olfr921 UTSW 9 38775720 missense possibly damaging 0.67
R3967:Olfr921 UTSW 9 38775368 missense probably benign 0.09
R3968:Olfr921 UTSW 9 38775368 missense probably benign 0.09
R3969:Olfr921 UTSW 9 38775368 missense probably benign 0.09
R4761:Olfr921 UTSW 9 38775837 missense probably benign 0.05
R4796:Olfr921 UTSW 9 38775374 missense probably benign 0.15
R4880:Olfr921 UTSW 9 38775547 nonsense probably null
R5237:Olfr921 UTSW 9 38775956 missense probably damaging 1.00
R5756:Olfr921 UTSW 9 38775258 start codon destroyed probably null 1.00
R6230:Olfr921 UTSW 9 38775777 missense possibly damaging 0.94
R6487:Olfr921 UTSW 9 38775435 missense probably damaging 1.00
R7514:Olfr921 UTSW 9 38775678 missense probably damaging 1.00
R7573:Olfr921 UTSW 9 38775495 missense probably damaging 1.00
R7755:Olfr921 UTSW 9 38775777 missense possibly damaging 0.94
R8195:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8197:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8199:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8211:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8212:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8236:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8239:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8279:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8282:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8283:Olfr921 UTSW 9 38775281 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- ACAAGCTATTCGGAAATTTCATCC -3'
(R):5'- TCATAGGCCATTGACACCAG -3'

Sequencing Primer
(F):5'- GCTATTCGGAAATTTCATCCTGAGC -3'
(R):5'- AAGTAGAGTTGGGACATACATCC -3'
Posted On2020-07-13