Incidental Mutation 'R8196:Slmap'
ID635463
Institutional Source Beutler Lab
Gene Symbol Slmap
Ensembl Gene ENSMUSG00000021870
Gene Namesarcolemma associated protein
SynonymsD330001L02Rik, Slap
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8196 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location26413168-26534931 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26468491 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 171 (Y171H)
Ref Sequence ENSEMBL: ENSMUSP00000117816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038522] [ENSMUST00000090359] [ENSMUST00000102956] [ENSMUST00000112330] [ENSMUST00000112331] [ENSMUST00000139075]
Predicted Effect probably damaging
Transcript: ENSMUST00000038522
AA Change: Y171H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046956
Gene: ENSMUSG00000021870
AA Change: Y171H

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 486 568 N/A INTRINSIC
coiled coil region 595 794 N/A INTRINSIC
transmembrane domain 796 818 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090359
AA Change: Y171H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087836
Gene: ENSMUSG00000021870
AA Change: Y171H

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 490 572 N/A INTRINSIC
coiled coil region 599 799 N/A INTRINSIC
transmembrane domain 801 823 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102956
AA Change: Y171H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100021
Gene: ENSMUSG00000021870
AA Change: Y171H

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 486 568 N/A INTRINSIC
coiled coil region 595 794 N/A INTRINSIC
transmembrane domain 796 818 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112330
AA Change: Y171H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107949
Gene: ENSMUSG00000021870
AA Change: Y171H

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 383 N/A INTRINSIC
coiled coil region 452 534 N/A INTRINSIC
coiled coil region 561 761 N/A INTRINSIC
transmembrane domain 763 785 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112331
AA Change: Y50H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107950
Gene: ENSMUSG00000021870
AA Change: Y50H

DomainStartEndE-ValueType
coiled coil region 46 78 N/A INTRINSIC
coiled coil region 109 260 N/A INTRINSIC
coiled coil region 352 434 N/A INTRINSIC
coiled coil region 461 661 N/A INTRINSIC
transmembrane domain 663 685 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139075
AA Change: Y171H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117816
Gene: ENSMUSG00000021870
AA Change: Y171H

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 507 589 N/A INTRINSIC
coiled coil region 616 816 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146438
SMART Domains Protein: ENSMUSP00000123344
Gene: ENSMUSG00000021870

DomainStartEndE-ValueType
coiled coil region 17 142 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of a conserved striatin-interacting phosphatase and kinase complex. Striatin family complexes participate in a variety of cellular processes including signaling, cell cycle control, cell migration, Golgi assembly, and apoptosis. The protein encoded by this gene is a coiled-coil, tail-anchored membrane protein with a single C-terminal transmembrane domain that is posttranslationally inserted into membranes. Mutations in this gene are associated with Brugada syndrome, a cardiac channelopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous inactivation in this locus affects T cell development. Mice homozygous for a transposon induced allele exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b T A 19: 21,678,660 V102D probably damaging Het
Adam6b T A 12: 113,490,467 D301E probably benign Het
Adnp A C 2: 168,183,172 D734E probably benign Het
Ank2 T A 3: 126,929,883 T932S probably damaging Het
Arhgap20 C A 9: 51,848,977 D709E possibly damaging Het
Atoh1 A G 6: 64,730,242 D307G probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
B3galt1 A G 2: 68,118,186 I82V probably benign Het
Chd2 T C 7: 73,468,537 D1111G probably benign Het
Csmd1 T C 8: 16,009,468 D2089G probably benign Het
Dach1 T A 14: 98,018,934 H296L probably damaging Het
Dennd4b T G 3: 90,271,597 L556R probably damaging Het
Dopey1 T A 9: 86,523,098 S326T probably benign Het
Eif2b5 T A 16: 20,502,556 H286Q probably damaging Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Fn3k T A 11: 121,450,396 F292L probably damaging Het
Gm1123 G A 9: 99,023,256 A67V probably benign Het
Hey2 C T 10: 30,834,277 C160Y probably benign Het
Jph2 T A 2: 163,338,701 probably null Het
Lars A G 18: 42,210,101 S1084P possibly damaging Het
Macf1 T C 4: 123,382,704 D6084G probably damaging Het
Mdfic G T 6: 15,740,990 A115S probably benign Het
Mki67 T C 7: 135,695,508 E2599G probably damaging Het
Mtus1 A G 8: 41,056,652 S131P probably benign Het
Muc16 G T 9: 18,645,334 T3221K unknown Het
Olfr147 A G 9: 38,403,608 S245G probably damaging Het
Olfr357 T A 2: 36,996,861 I17N possibly damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pdgfc A G 3: 81,037,504 E23G possibly damaging Het
Pfkp T C 13: 6,605,662 T312A probably benign Het
Pxn A G 5: 115,545,709 E200G probably damaging Het
Rai1 C T 11: 60,185,970 H287Y probably damaging Het
Rap1gap G A 4: 137,717,964 V319I probably benign Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Selp A T 1: 164,133,921 D401V possibly damaging Het
Sh3bp5 A G 14: 31,417,442 V58A probably benign Het
Shpk A T 11: 73,203,949 I64F probably benign Het
Tmem67 T C 4: 12,075,661 T183A probably benign Het
Tyw1 G T 5: 130,300,021 L549F probably damaging Het
Uhrf2 T A 19: 30,073,929 M301K probably benign Het
Uvssa G A 5: 33,410,967 V532I probably benign Het
Vmn2r113 A T 17: 22,957,964 K574I probably damaging Het
Zfp52 A G 17: 21,561,894 N668S possibly damaging Het
Other mutations in Slmap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02402:Slmap APN 14 26463710 missense probably damaging 0.97
IGL02612:Slmap APN 14 26459466 splice site probably benign
IGL02630:Slmap APN 14 26422431 missense possibly damaging 0.93
IGL02798:Slmap APN 14 26470378 missense possibly damaging 0.88
PIT4382001:Slmap UTSW 14 26533431 missense probably damaging 1.00
R0433:Slmap UTSW 14 26453594 nonsense probably null
R0963:Slmap UTSW 14 26468520 missense probably damaging 1.00
R1721:Slmap UTSW 14 26460218 splice site probably benign
R1848:Slmap UTSW 14 26422574 missense probably benign
R2151:Slmap UTSW 14 26418247 missense probably damaging 1.00
R2152:Slmap UTSW 14 26418247 missense probably damaging 1.00
R2153:Slmap UTSW 14 26418247 missense probably damaging 1.00
R2154:Slmap UTSW 14 26418247 missense probably damaging 1.00
R3725:Slmap UTSW 14 26427242 missense probably damaging 0.99
R3726:Slmap UTSW 14 26427242 missense probably damaging 0.99
R3935:Slmap UTSW 14 26459415 missense probably benign
R4118:Slmap UTSW 14 26482872 missense probably damaging 0.99
R4594:Slmap UTSW 14 26465617 missense probably damaging 1.00
R4731:Slmap UTSW 14 26468535 missense probably damaging 0.97
R4732:Slmap UTSW 14 26468535 missense probably damaging 0.97
R4733:Slmap UTSW 14 26468535 missense probably damaging 0.97
R4817:Slmap UTSW 14 26462352 missense probably damaging 0.97
R4847:Slmap UTSW 14 26426608 missense possibly damaging 0.90
R4860:Slmap UTSW 14 26460209 missense probably benign 0.22
R4860:Slmap UTSW 14 26460209 missense probably benign 0.22
R5092:Slmap UTSW 14 26463589 missense probably damaging 1.00
R5211:Slmap UTSW 14 26482962 missense probably damaging 1.00
R5387:Slmap UTSW 14 26459933 missense probably benign 0.22
R5821:Slmap UTSW 14 26462280 missense probably damaging 1.00
R6404:Slmap UTSW 14 26422411 splice site probably null
R6856:Slmap UTSW 14 26430092 splice site probably null
R6977:Slmap UTSW 14 26533419 missense probably damaging 1.00
R7108:Slmap UTSW 14 26422521 missense probably benign 0.04
R7320:Slmap UTSW 14 26460072 missense possibly damaging 0.53
R7470:Slmap UTSW 14 26427420 missense probably benign
R7520:Slmap UTSW 14 26427420 missense probably benign
R7540:Slmap UTSW 14 26460191 missense probably damaging 0.99
R7544:Slmap UTSW 14 26429846 missense probably damaging 0.99
R7544:Slmap UTSW 14 26429848 missense probably damaging 0.99
R8112:Slmap UTSW 14 26422548 missense probably damaging 1.00
R8153:Slmap UTSW 14 26533333 missense probably benign
R8300:Slmap UTSW 14 26418219 missense possibly damaging 0.62
R8523:Slmap UTSW 14 26429810 missense probably damaging 0.99
Z1177:Slmap UTSW 14 26533450 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACTTAGCAATCTTGACCCTTTT -3'
(R):5'- TCTGTGCATGCTCCCTGTGA -3'

Sequencing Primer
(F):5'- AATCTTGACCCTTTTTCTTCACAAG -3'
(R):5'- CTGATACAGAGGGATGCTGCTTAC -3'
Posted On2020-07-13