Incidental Mutation 'R8197:Dpp4'
ID635476
Institutional Source Beutler Lab
Gene Symbol Dpp4
Ensembl Gene ENSMUSG00000035000
Gene Namedipeptidylpeptidase 4
SynonymsDpp-4, THAM, Cd26
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8197 (G1)
Quality Score208.009
Status Not validated
Chromosome2
Chromosomal Location62330073-62412231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62372827 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 266 (N266S)
Ref Sequence ENSEMBL: ENSMUSP00000044050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047812]
Predicted Effect probably benign
Transcript: ENSMUST00000047812
AA Change: N266S

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044050
Gene: ENSMUSG00000035000
AA Change: N266S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 102 473 5.7e-110 PFAM
Pfam:Abhydrolase_5 545 752 1e-11 PFAM
Pfam:DLH 546 754 4e-7 PFAM
Pfam:Peptidase_S9 551 760 3.4e-61 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is identical to adenosine deaminase complexing protein-2, and to the T-cell activation antigen CD26. It is an intrinsic membrane glycoprotein and a serine exopeptidase that cleaves X-proline dipeptides from the N-terminus of polypeptides. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show hypoglycemia, hyperinsulinemia, and increased plasma glucagon-like peptide 1 in glucose tolerance tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3010026O09Rik A G 11: 50,199,780 E257G probably benign Het
Aars T A 8: 111,053,996 D836E probably benign Het
Abca6 A C 11: 110,211,815 L861R probably damaging Het
Adamts18 G T 8: 113,754,595 A560E probably damaging Het
Adra2b A T 2: 127,364,658 Q365L possibly damaging Het
Anxa3 A G 5: 96,834,792 T250A probably benign Het
B4galt5 T A 2: 167,302,103 N309I probably benign Het
Bub1 G T 2: 127,801,257 R1056S probably damaging Het
Ccdc185 G T 1: 182,748,759 P122T possibly damaging Het
Cdk5rap3 A G 11: 96,916,149 probably null Het
Cntnap4 T A 8: 112,570,225 Y31N probably benign Het
Crygc T C 1: 65,073,206 M70V probably benign Het
Dnah14 A G 1: 181,690,101 E2000G possibly damaging Het
Edrf1 T A 7: 133,647,359 D304E probably benign Het
Fabp9 T G 3: 10,194,827 K42T probably benign Het
Fhl4 T A 10: 85,098,237 I227F probably damaging Het
Gm14124 A T 2: 150,267,657 H89L possibly damaging Het
Gsdmd T C 15: 75,864,337 I105T possibly damaging Het
Gys1 A G 7: 45,442,924 D317G possibly damaging Het
Hrh4 A G 18: 13,021,929 Y175C probably damaging Het
Igfals A G 17: 24,880,304 N123S probably benign Het
Igkv5-37 A G 6: 69,963,857 V2A possibly damaging Het
Iqsec3 A G 6: 121,413,012 L500P unknown Het
Itgae G A 11: 73,120,384 R660Q probably benign Het
Kcnip2 T C 19: 45,794,291 I204V possibly damaging Het
Kndc1 A G 7: 139,913,531 E471G probably damaging Het
Lrrtm3 T A 10: 64,088,516 T291S possibly damaging Het
Mast1 T A 8: 84,912,821 H1293L possibly damaging Het
Myo9b T C 8: 71,290,963 Y223H probably damaging Het
Nab1 G A 1: 52,489,968 R257* probably null Het
Ncapd3 C A 9: 27,086,033 L1217I probably damaging Het
Olfr186 T A 16: 59,027,085 D274V probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pde4d T A 13: 109,948,336 I489N probably damaging Het
Pdyn C T 2: 129,688,357 G131R probably benign Het
Qrich2 CACCTGCTTGCAACACACCAGGCTGAACTGGACCT CACCT 11: 116,457,035 probably benign Het
Rps6ka1 T C 4: 133,865,362 K276E possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Scube2 T A 7: 109,808,477 N752I possibly damaging Het
Scyl2 T C 10: 89,662,366 I194V probably benign Het
Sec31b T G 19: 44,524,516 R511S probably benign Het
Serpinb6d T C 13: 33,667,605 F115S probably damaging Het
Supt16 G A 14: 52,174,085 P614S possibly damaging Het
Tmem114 T C 16: 8,409,652 I182M probably damaging Het
Vmn1r125 G A 7: 21,272,926 V250I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp959 A T 17: 55,897,677 D238V probably damaging Het
Other mutations in Dpp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Dpp4 APN 2 62379302 missense probably damaging 1.00
IGL02205:Dpp4 APN 2 62352257 missense probably damaging 1.00
IGL02276:Dpp4 APN 2 62356951 splice site probably benign
IGL02335:Dpp4 APN 2 62334644 missense probably benign 0.03
IGL02615:Dpp4 APN 2 62359328 missense probably damaging 1.00
IGL02639:Dpp4 APN 2 62352240 missense probably benign
IGL02972:Dpp4 APN 2 62352225 missense probably damaging 1.00
IGL03366:Dpp4 APN 2 62356957 splice site probably null
caribou UTSW 2 62347901 missense possibly damaging 0.69
PIT4449001:Dpp4 UTSW 2 62356644 missense probably benign 0.00
R0502:Dpp4 UTSW 2 62364988 missense probably damaging 0.99
R0581:Dpp4 UTSW 2 62356676 missense probably benign
R1004:Dpp4 UTSW 2 62332640 missense probably benign 0.08
R1075:Dpp4 UTSW 2 62352286 missense probably benign 0.39
R1476:Dpp4 UTSW 2 62347901 missense possibly damaging 0.69
R1702:Dpp4 UTSW 2 62386429 critical splice donor site probably null
R1707:Dpp4 UTSW 2 62359335 splice site probably benign
R1733:Dpp4 UTSW 2 62372869 critical splice acceptor site probably null
R1899:Dpp4 UTSW 2 62345050 splice site probably benign
R2264:Dpp4 UTSW 2 62378239 missense possibly damaging 0.71
R2496:Dpp4 UTSW 2 62387133 missense possibly damaging 0.90
R3765:Dpp4 UTSW 2 62386436 missense probably benign 0.17
R4278:Dpp4 UTSW 2 62379323 missense probably damaging 1.00
R4413:Dpp4 UTSW 2 62387140 missense possibly damaging 0.89
R4432:Dpp4 UTSW 2 62345112 missense probably damaging 1.00
R4647:Dpp4 UTSW 2 62334605 missense probably damaging 1.00
R4710:Dpp4 UTSW 2 62360315 missense probably benign 0.04
R4914:Dpp4 UTSW 2 62347892 missense probably benign 0.20
R5173:Dpp4 UTSW 2 62387130 missense probably damaging 1.00
R5283:Dpp4 UTSW 2 62360336 missense probably damaging 1.00
R5698:Dpp4 UTSW 2 62334311 missense probably damaging 1.00
R6621:Dpp4 UTSW 2 62352140 missense probably damaging 1.00
R6681:Dpp4 UTSW 2 62348549 missense probably benign 0.01
R6739:Dpp4 UTSW 2 62387095 missense probably benign
R6962:Dpp4 UTSW 2 62372830 missense probably benign 0.11
R7249:Dpp4 UTSW 2 62385203 missense probably benign 0.14
R7268:Dpp4 UTSW 2 62347842 missense probably damaging 1.00
R7343:Dpp4 UTSW 2 62358901 nonsense probably null
R7357:Dpp4 UTSW 2 62387077 missense probably benign
R7366:Dpp4 UTSW 2 62354599 missense probably damaging 1.00
R7413:Dpp4 UTSW 2 62356989 missense probably damaging 1.00
R7431:Dpp4 UTSW 2 62352238 missense probably benign 0.01
R7642:Dpp4 UTSW 2 62360283 critical splice donor site probably null
R8004:Dpp4 UTSW 2 62358828 missense probably benign 0.00
R8341:Dpp4 UTSW 2 62347890 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GTTCACTGTGCATACCCATCAC -3'
(R):5'- TTCTGAGCAAGCAAACACGC -3'

Sequencing Primer
(F):5'- AATCAAGGATACAAGATGATGCTATG -3'
(R):5'- CATTATCAATTCTGTGGTTTTTC -3'
Posted On2020-07-13