Incidental Mutation 'R8197:Scube2'
ID 635490
Institutional Source Beutler Lab
Gene Symbol Scube2
Ensembl Gene ENSMUSG00000007279
Gene Name signal peptide, CUB domain, EGF-like 2
Synonyms ICRFP703N2430Q5.1, 4932442O19Rik, Cegf1, ICRFP703B1614Q5.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.440) question?
Stock # R8197 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 109798676-109865679 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 109808477 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 752 (N752I)
Ref Sequence ENSEMBL: ENSMUSP00000102340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007423] [ENSMUST00000106728] [ENSMUST00000106729]
AlphaFold Q9JJS0
Predicted Effect possibly damaging
Transcript: ENSMUST00000007423
AA Change: N781I

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000007423
Gene: ENSMUSG00000007279
AA Change: N781I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 479 490 N/A INTRINSIC
low complexity region 577 594 N/A INTRINSIC
Pfam:GCC2_GCC3 642 692 7.2e-19 PFAM
Pfam:GCC2_GCC3 699 746 2e-16 PFAM
Pfam:GCC2_GCC3 755 802 3.1e-18 PFAM
CUB 807 919 1.23e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106728
AA Change: N655I

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000102339
Gene: ENSMUSG00000007279
AA Change: N655I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 451 468 N/A INTRINSIC
Pfam:GCC2_GCC3 516 566 6.4e-17 PFAM
Pfam:GCC2_GCC3 573 620 3.5e-14 PFAM
Pfam:GCC2_GCC3 629 676 5.4e-16 PFAM
Blast:CUB 678 727 2e-25 BLAST
Blast:CUB 730 796 1e-37 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000106729
AA Change: N752I

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102340
Gene: ENSMUSG00000007279
AA Change: N752I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 605 622 N/A INTRINSIC
Pfam:GCC2_GCC3 670 717 1.8e-16 PFAM
Pfam:GCC2_GCC3 726 773 2.7e-18 PFAM
CUB 778 890 1.23e-19 SMART
Meta Mutation Damage Score 0.1417 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 96% (46/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are smaller than controls. Mice also exhibit defective endochondral bone formation and impaired Ihh-mediated chondrocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3010026O09Rik A G 11: 50,199,780 E257G probably benign Het
Aars T A 8: 111,053,996 D836E probably benign Het
Abca6 A C 11: 110,211,815 L861R probably damaging Het
Adamts18 G T 8: 113,754,595 A560E probably damaging Het
Adra2b A T 2: 127,364,658 Q365L possibly damaging Het
Anxa3 A G 5: 96,834,792 T250A probably benign Het
B4galt5 T A 2: 167,302,103 N309I probably benign Het
Bub1 G T 2: 127,801,257 R1056S probably damaging Het
Ccdc185 G T 1: 182,748,759 P122T possibly damaging Het
Cdk5rap3 A G 11: 96,916,149 probably null Het
Cntnap4 T A 8: 112,570,225 Y31N probably benign Het
Crygc T C 1: 65,073,206 M70V probably benign Het
Dnah14 A G 1: 181,690,101 E2000G possibly damaging Het
Dpp4 T C 2: 62,372,827 N266S probably benign Het
Edrf1 T A 7: 133,647,359 D304E probably benign Het
Fabp9 T G 3: 10,194,827 K42T probably benign Het
Fhl4 T A 10: 85,098,237 I227F probably damaging Het
Gm13941 T C 2: 111,096,576 probably null Het
Gm14124 A T 2: 150,267,657 H89L possibly damaging Het
Gsdmd T C 15: 75,864,337 I105T possibly damaging Het
Gys1 A G 7: 45,442,924 D317G possibly damaging Het
Hrh4 A G 18: 13,021,929 Y175C probably damaging Het
Igfals A G 17: 24,880,304 N123S probably benign Het
Igkv5-37 A G 6: 69,963,857 V2A possibly damaging Het
Iqsec3 A G 6: 121,413,012 L500P unknown Het
Itgae G A 11: 73,120,384 R660Q probably benign Het
Kcnip2 T C 19: 45,794,291 I204V possibly damaging Het
Kndc1 A G 7: 139,913,531 E471G probably damaging Het
Lrrtm3 T A 10: 64,088,516 T291S possibly damaging Het
Mast1 T A 8: 84,912,821 H1293L possibly damaging Het
Myo9b T C 8: 71,290,963 Y223H probably damaging Het
Nab1 G A 1: 52,489,968 R257* probably null Het
Ncapd3 C A 9: 27,086,033 L1217I probably damaging Het
Olfr186 T A 16: 59,027,085 D274V probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pde4d T A 13: 109,948,336 I489N probably damaging Het
Pdyn C T 2: 129,688,357 G131R probably benign Het
Qrich2 CACCTGCTTGCAACACACCAGGCTGAACTGGACCT CACCT 11: 116,457,035 probably benign Het
Rps6ka1 T C 4: 133,865,362 K276E possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Scyl2 T C 10: 89,662,366 I194V probably benign Het
Sec31b T G 19: 44,524,516 R511S probably benign Het
Serpinb6d T C 13: 33,667,605 F115S probably damaging Het
Skint6 T G 4: 112,894,843 probably null Het
Supt16 G A 14: 52,174,085 P614S possibly damaging Het
Tmem114 T C 16: 8,409,652 I182M probably damaging Het
Vmn1r125 G A 7: 21,272,926 V250I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp959 A T 17: 55,897,677 D238V probably damaging Het
Other mutations in Scube2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Scube2 APN 7 109808454 missense probably damaging 1.00
IGL01608:Scube2 APN 7 109843254 missense probably benign
IGL02080:Scube2 APN 7 109852478 missense probably damaging 1.00
PIT4445001:Scube2 UTSW 7 109809180 missense probably benign 0.22
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0106:Scube2 UTSW 7 109846908 splice site probably benign
R0230:Scube2 UTSW 7 109824764 critical splice donor site probably null
R0255:Scube2 UTSW 7 109824872 missense probably damaging 0.98
R0427:Scube2 UTSW 7 109824837 missense probably benign 0.00
R0612:Scube2 UTSW 7 109804764 splice site probably benign
R0658:Scube2 UTSW 7 109837120 splice site probably benign
R0687:Scube2 UTSW 7 109829128 missense possibly damaging 0.47
R1087:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1366:Scube2 UTSW 7 109804614 missense probably damaging 1.00
R1635:Scube2 UTSW 7 109843214 missense possibly damaging 0.90
R1797:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1972:Scube2 UTSW 7 109809214 missense probably benign 0.16
R2080:Scube2 UTSW 7 109808505 missense possibly damaging 0.77
R2254:Scube2 UTSW 7 109825459 missense possibly damaging 0.47
R2315:Scube2 UTSW 7 109804701 missense probably damaging 1.00
R2325:Scube2 UTSW 7 109843954 missense probably damaging 1.00
R3723:Scube2 UTSW 7 109808406 splice site probably benign
R3887:Scube2 UTSW 7 109843176 splice site probably benign
R3946:Scube2 UTSW 7 109857590 missense possibly damaging 0.81
R4030:Scube2 UTSW 7 109831771 missense probably benign 0.09
R4621:Scube2 UTSW 7 109800650 missense possibly damaging 0.63
R4684:Scube2 UTSW 7 109810713 missense probably damaging 0.96
R4736:Scube2 UTSW 7 109831205 missense probably benign 0.01
R5096:Scube2 UTSW 7 109799244 utr 3 prime probably benign
R5266:Scube2 UTSW 7 109809230 missense probably damaging 1.00
R5579:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R5669:Scube2 UTSW 7 109825439 missense probably benign 0.04
R5838:Scube2 UTSW 7 109808444 missense probably damaging 1.00
R5916:Scube2 UTSW 7 109831724 missense possibly damaging 0.77
R6056:Scube2 UTSW 7 109833013 nonsense probably null
R6731:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R6785:Scube2 UTSW 7 109810617 missense probably benign
R8250:Scube2 UTSW 7 109864170 missense probably benign 0.20
R8273:Scube2 UTSW 7 109809176 missense probably benign 0.00
R8427:Scube2 UTSW 7 109800590 missense probably damaging 1.00
R8882:Scube2 UTSW 7 109852473 missense probably damaging 1.00
R9258:Scube2 UTSW 7 109799308 missense probably damaging 1.00
R9428:Scube2 UTSW 7 109829138 missense probably benign 0.32
R9476:Scube2 UTSW 7 109831762 missense probably damaging 1.00
R9510:Scube2 UTSW 7 109831762 missense probably damaging 1.00
R9709:Scube2 UTSW 7 109831764 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109838127 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109843201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAATGGACCTGGAATCCTG -3'
(R):5'- CTCTCACTCTGGCTATTGAGGG -3'

Sequencing Primer
(F):5'- AATGGACCTGGAATCCTGGCTAC -3'
(R):5'- GCTTACCAGGAAAGCAGTATTTC -3'
Posted On 2020-07-13