Incidental Mutation 'R8197:Edrf1'
Institutional Source Beutler Lab
Gene Symbol Edrf1
Ensembl Gene ENSMUSG00000039990
Gene Nameerythroid differentiation regulatory factor 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.585) question?
Stock #R8197 (G1)
Quality Score225.009
Status Validated
Chromosomal Location133637543-133672971 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 133647359 bp
Amino Acid Change Aspartic acid to Glutamic Acid at position 304 (D304E)
Ref Sequence ENSEMBL: ENSMUSP00000059166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051169] [ENSMUST00000128901]
Predicted Effect probably benign
Transcript: ENSMUST00000051169
AA Change: D304E

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000059166
Gene: ENSMUSG00000039990
AA Change: D304E

low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1229 1237 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000128901
AA Change: D270E

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115641
Gene: ENSMUSG00000039990
AA Change: D270E

low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 433 443 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 1137 1150 N/A INTRINSIC
low complexity region 1195 1203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene may play a role in erythroid cell differentiation. The encoded protein inhibits DNA binding of the erythroid transcription factor GATA-1 and may regulate the expression of alpha-globin and gamma-globin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3010026O09Rik A G 11: 50,199,780 E257G probably benign Het
Aars T A 8: 111,053,996 D836E probably benign Het
Abca6 A C 11: 110,211,815 L861R probably damaging Het
Adamts18 G T 8: 113,754,595 A560E probably damaging Het
Adra2b A T 2: 127,364,658 Q365L possibly damaging Het
Anxa3 A G 5: 96,834,792 T250A probably benign Het
B4galt5 T A 2: 167,302,103 N309I probably benign Het
Bub1 G T 2: 127,801,257 R1056S probably damaging Het
Ccdc185 G T 1: 182,748,759 P122T possibly damaging Het
Cdk5rap3 A G 11: 96,916,149 probably null Het
Cntnap4 T A 8: 112,570,225 Y31N probably benign Het
Crygc T C 1: 65,073,206 M70V probably benign Het
Dnah14 A G 1: 181,690,101 E2000G possibly damaging Het
Dpp4 T C 2: 62,372,827 N266S probably benign Het
Fabp9 T G 3: 10,194,827 K42T probably benign Het
Fhl4 T A 10: 85,098,237 I227F probably damaging Het
Gm13941 T C 2: 111,096,576 probably null Het
Gm14124 A T 2: 150,267,657 H89L possibly damaging Het
Gsdmd T C 15: 75,864,337 I105T possibly damaging Het
Gys1 A G 7: 45,442,924 D317G possibly damaging Het
Hrh4 A G 18: 13,021,929 Y175C probably damaging Het
Igfals A G 17: 24,880,304 N123S probably benign Het
Igkv5-37 A G 6: 69,963,857 V2A possibly damaging Het
Iqsec3 A G 6: 121,413,012 L500P unknown Het
Itgae G A 11: 73,120,384 R660Q probably benign Het
Kcnip2 T C 19: 45,794,291 I204V possibly damaging Het
Kndc1 A G 7: 139,913,531 E471G probably damaging Het
Lrrtm3 T A 10: 64,088,516 T291S possibly damaging Het
Mast1 T A 8: 84,912,821 H1293L possibly damaging Het
Myo9b T C 8: 71,290,963 Y223H probably damaging Het
Nab1 G A 1: 52,489,968 R257* probably null Het
Ncapd3 C A 9: 27,086,033 L1217I probably damaging Het
Olfr186 T A 16: 59,027,085 D274V probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pde4d T A 13: 109,948,336 I489N probably damaging Het
Pdyn C T 2: 129,688,357 G131R probably benign Het
Qrich2 CACCTGCTTGCAACACACCAGGCTGAACTGGACCT CACCT 11: 116,457,035 probably benign Het
Rps6ka1 T C 4: 133,865,362 K276E possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Scube2 T A 7: 109,808,477 N752I possibly damaging Het
Scyl2 T C 10: 89,662,366 I194V probably benign Het
Sec31b T G 19: 44,524,516 R511S probably benign Het
Serpinb6d T C 13: 33,667,605 F115S probably damaging Het
Skint6 T G 4: 112,894,843 probably null Het
Supt16 G A 14: 52,174,085 P614S possibly damaging Het
Tmem114 T C 16: 8,409,652 I182M probably damaging Het
Vmn1r125 G A 7: 21,272,926 V250I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp959 A T 17: 55,897,677 D238V probably damaging Het
Other mutations in Edrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Edrf1 APN 7 133658553 nonsense probably null
IGL01637:Edrf1 APN 7 133650525 missense probably damaging 1.00
IGL01697:Edrf1 APN 7 133643730 missense probably benign 0.02
IGL01893:Edrf1 APN 7 133657102 missense probably benign 0.09
IGL02202:Edrf1 APN 7 133656970 missense probably benign 0.00
IGL02278:Edrf1 APN 7 133657000 missense probably benign 0.00
IGL02382:Edrf1 APN 7 133650615 splice site probably benign
IGL02743:Edrf1 APN 7 133656491 unclassified probably benign
R0265:Edrf1 UTSW 7 133657045 missense probably damaging 1.00
R0282:Edrf1 UTSW 7 133644022 missense probably benign 0.21
R1167:Edrf1 UTSW 7 133644066 missense probably benign 0.08
R1633:Edrf1 UTSW 7 133652140 missense probably damaging 1.00
R2039:Edrf1 UTSW 7 133653949 nonsense probably null
R2060:Edrf1 UTSW 7 133657129 nonsense probably null
R2920:Edrf1 UTSW 7 133667572 missense probably benign 0.00
R4770:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R4887:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R4888:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R5135:Edrf1 UTSW 7 133651044 missense probably benign 0.03
R5156:Edrf1 UTSW 7 133660179 missense probably damaging 1.00
R5290:Edrf1 UTSW 7 133650566 missense probably damaging 0.98
R5342:Edrf1 UTSW 7 133651910 splice site probably null
R5416:Edrf1 UTSW 7 133641402 missense possibly damaging 0.52
R5450:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R5906:Edrf1 UTSW 7 133663415 missense probably benign
R6272:Edrf1 UTSW 7 133637808 start gained probably benign
R6275:Edrf1 UTSW 7 133667582 missense possibly damaging 0.60
R7144:Edrf1 UTSW 7 133637849 missense probably benign
R7244:Edrf1 UTSW 7 133654350 missense probably benign 0.01
R7716:Edrf1 UTSW 7 133643726 missense probably damaging 0.99
R8193:Edrf1 UTSW 7 133661877 missense possibly damaging 0.95
R8553:Edrf1 UTSW 7 133650318 missense possibly damaging 0.88
R8710:Edrf1 UTSW 7 133643766 missense probably damaging 1.00
R8839:Edrf1 UTSW 7 133653915 missense probably benign 0.00
R9035:Edrf1 UTSW 7 133643702 missense probably damaging 0.97
R9051:Edrf1 UTSW 7 133671478 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2020-07-13