Incidental Mutation 'R8197:Itgae'
ID635504
Institutional Source Beutler Lab
Gene Symbol Itgae
Ensembl Gene ENSMUSG00000005947
Gene Nameintegrin alpha E, epithelial-associated
SynonymsCD103, alpha-E1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8197 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73090583-73147446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73120384 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 660 (R660Q)
Ref Sequence ENSEMBL: ENSMUSP00000006101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]
Predicted Effect probably benign
Transcript: ENSMUST00000006101
AA Change: R660Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: R660Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 1e-24 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102537
AA Change: R660Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: R660Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 5e-25 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3010026O09Rik A G 11: 50,199,780 E257G probably benign Het
Aars T A 8: 111,053,996 D836E probably benign Het
Abca6 A C 11: 110,211,815 L861R probably damaging Het
Adamts18 G T 8: 113,754,595 A560E probably damaging Het
Adra2b A T 2: 127,364,658 Q365L possibly damaging Het
Anxa3 A G 5: 96,834,792 T250A probably benign Het
B4galt5 T A 2: 167,302,103 N309I probably benign Het
Bub1 G T 2: 127,801,257 R1056S probably damaging Het
Ccdc185 G T 1: 182,748,759 P122T possibly damaging Het
Cdk5rap3 A G 11: 96,916,149 probably null Het
Cntnap4 T A 8: 112,570,225 Y31N probably benign Het
Crygc T C 1: 65,073,206 M70V probably benign Het
Dnah14 A G 1: 181,690,101 E2000G possibly damaging Het
Dpp4 T C 2: 62,372,827 N266S probably benign Het
Edrf1 T A 7: 133,647,359 D304E probably benign Het
Fabp9 T G 3: 10,194,827 K42T probably benign Het
Fhl4 T A 10: 85,098,237 I227F probably damaging Het
Gm13941 T C 2: 111,096,576 probably null Het
Gm14124 A T 2: 150,267,657 H89L possibly damaging Het
Gsdmd T C 15: 75,864,337 I105T possibly damaging Het
Gys1 A G 7: 45,442,924 D317G possibly damaging Het
Hrh4 A G 18: 13,021,929 Y175C probably damaging Het
Igfals A G 17: 24,880,304 N123S probably benign Het
Igkv5-37 A G 6: 69,963,857 V2A possibly damaging Het
Iqsec3 A G 6: 121,413,012 L500P unknown Het
Kcnip2 T C 19: 45,794,291 I204V possibly damaging Het
Kndc1 A G 7: 139,913,531 E471G probably damaging Het
Lrrtm3 T A 10: 64,088,516 T291S possibly damaging Het
Mast1 T A 8: 84,912,821 H1293L possibly damaging Het
Myo9b T C 8: 71,290,963 Y223H probably damaging Het
Nab1 G A 1: 52,489,968 R257* probably null Het
Ncapd3 C A 9: 27,086,033 L1217I probably damaging Het
Olfr186 T A 16: 59,027,085 D274V probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pde4d T A 13: 109,948,336 I489N probably damaging Het
Pdyn C T 2: 129,688,357 G131R probably benign Het
Qrich2 CACCTGCTTGCAACACACCAGGCTGAACTGGACCT CACCT 11: 116,457,035 probably benign Het
Rps6ka1 T C 4: 133,865,362 K276E possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Scube2 T A 7: 109,808,477 N752I possibly damaging Het
Scyl2 T C 10: 89,662,366 I194V probably benign Het
Sec31b T G 19: 44,524,516 R511S probably benign Het
Serpinb6d T C 13: 33,667,605 F115S probably damaging Het
Skint6 T G 4: 112,894,843 probably null Het
Supt16 G A 14: 52,174,085 P614S possibly damaging Het
Tmem114 T C 16: 8,409,652 I182M probably damaging Het
Vmn1r125 G A 7: 21,272,926 V250I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp959 A T 17: 55,897,677 D238V probably damaging Het
Other mutations in Itgae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Itgae APN 11 73145635 missense probably benign 0.17
IGL00472:Itgae APN 11 73113694 missense probably benign 0.06
IGL00821:Itgae APN 11 73123148 missense probably damaging 1.00
IGL01625:Itgae APN 11 73119437 missense probably benign 0.00
IGL01639:Itgae APN 11 73119378 missense probably benign 0.00
IGL01743:Itgae APN 11 73111759 missense probably benign 0.02
IGL01911:Itgae APN 11 73116137 missense probably damaging 1.00
IGL01949:Itgae APN 11 73118184 missense probably benign 0.29
IGL02149:Itgae APN 11 73103894 missense probably benign 0.04
IGL02179:Itgae APN 11 73134018 missense probably benign 0.06
IGL02231:Itgae APN 11 73090622 missense possibly damaging 0.88
IGL02292:Itgae APN 11 73118535 missense probably damaging 0.98
IGL02378:Itgae APN 11 73118121 missense probably benign 0.00
IGL02525:Itgae APN 11 73130951 missense probably damaging 0.98
IGL02576:Itgae APN 11 73118505 missense possibly damaging 0.95
IGL02729:Itgae APN 11 73118203 splice site probably benign
IGL02859:Itgae APN 11 73114867 missense probably damaging 1.00
IGL03074:Itgae APN 11 73125310 missense probably benign 0.00
IGL03107:Itgae APN 11 73113601 missense probably damaging 1.00
IGL03264:Itgae APN 11 73115574 missense possibly damaging 0.73
IGL03272:Itgae APN 11 73133854 splice site probably null
IGL03352:Itgae APN 11 73131730 missense probably damaging 1.00
R0134:Itgae UTSW 11 73111342 missense probably benign 0.00
R0225:Itgae UTSW 11 73111342 missense probably benign 0.00
R0320:Itgae UTSW 11 73130999 missense possibly damaging 0.74
R0344:Itgae UTSW 11 73118147 missense probably benign 0.13
R0403:Itgae UTSW 11 73123183 missense possibly damaging 0.89
R0631:Itgae UTSW 11 73114907 missense probably damaging 1.00
R0833:Itgae UTSW 11 73129206 missense probably benign 0.02
R0836:Itgae UTSW 11 73129206 missense probably benign 0.02
R0973:Itgae UTSW 11 73138509 nonsense probably null
R1231:Itgae UTSW 11 73119379 missense probably benign 0.02
R1389:Itgae UTSW 11 73125362 missense probably damaging 1.00
R1433:Itgae UTSW 11 73115592 missense probably damaging 1.00
R1534:Itgae UTSW 11 73145605 missense possibly damaging 0.58
R1833:Itgae UTSW 11 73117162 missense possibly damaging 0.94
R1914:Itgae UTSW 11 73118643 splice site probably benign
R1915:Itgae UTSW 11 73118643 splice site probably benign
R2061:Itgae UTSW 11 73118622 missense probably benign 0.00
R2380:Itgae UTSW 11 73145569 missense probably benign 0.00
R2435:Itgae UTSW 11 73121937 nonsense probably null
R2680:Itgae UTSW 11 73114926 missense probably damaging 1.00
R2886:Itgae UTSW 11 73140687 missense probably benign 0.04
R3873:Itgae UTSW 11 73113616 missense probably damaging 1.00
R3923:Itgae UTSW 11 73116143 missense probably damaging 0.99
R4010:Itgae UTSW 11 73111339 missense probably benign 0.00
R4059:Itgae UTSW 11 73112134 missense probably benign
R4212:Itgae UTSW 11 73119352 missense probably benign
R4213:Itgae UTSW 11 73119352 missense probably benign
R4691:Itgae UTSW 11 73119519 nonsense probably null
R4736:Itgae UTSW 11 73114880 missense possibly damaging 0.79
R5152:Itgae UTSW 11 73130995 missense probably damaging 1.00
R5201:Itgae UTSW 11 73110556 missense probably benign 0.00
R5307:Itgae UTSW 11 73145638 missense probably benign 0.00
R5362:Itgae UTSW 11 73111849 missense probably damaging 1.00
R5448:Itgae UTSW 11 73133908 critical splice donor site probably null
R5645:Itgae UTSW 11 73129248 missense probably damaging 1.00
R5672:Itgae UTSW 11 73145551 missense possibly damaging 0.96
R6079:Itgae UTSW 11 73115574 missense possibly damaging 0.73
R6138:Itgae UTSW 11 73115574 missense possibly damaging 0.73
R6226:Itgae UTSW 11 73140757 missense probably benign 0.11
R6244:Itgae UTSW 11 73145601 missense probably damaging 0.96
R6326:Itgae UTSW 11 73131693 missense possibly damaging 0.88
R6332:Itgae UTSW 11 73111402 splice site probably null
R6502:Itgae UTSW 11 73145592 missense probably benign 0.10
R6825:Itgae UTSW 11 73118496 missense possibly damaging 0.89
R7016:Itgae UTSW 11 73119516 missense probably damaging 0.99
R7020:Itgae UTSW 11 73111369 missense probably damaging 1.00
R7069:Itgae UTSW 11 73116143 missense probably damaging 0.99
R7132:Itgae UTSW 11 73111358 missense possibly damaging 0.93
R7473:Itgae UTSW 11 73140678 missense possibly damaging 0.87
R7599:Itgae UTSW 11 73121960 missense possibly damaging 0.62
R7637:Itgae UTSW 11 73113631 missense probably damaging 1.00
R7763:Itgae UTSW 11 73123269 critical splice donor site probably null
R7829:Itgae UTSW 11 73138792 missense probably benign
R7860:Itgae UTSW 11 73120273 critical splice acceptor site probably null
R7978:Itgae UTSW 11 73134087 missense probably damaging 0.98
R8911:Itgae UTSW 11 73113621 missense probably damaging 1.00
U15987:Itgae UTSW 11 73115574 missense possibly damaging 0.73
X0024:Itgae UTSW 11 73111376 missense probably benign 0.01
Z1186:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1186:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1186:Itgae UTSW 11 73115640 missense probably benign
Z1186:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1186:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1186:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1186:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1187:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1187:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1187:Itgae UTSW 11 73115640 missense probably benign
Z1187:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1187:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1187:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1187:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1188:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1188:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1188:Itgae UTSW 11 73115640 missense probably benign
Z1188:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1188:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1188:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1188:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1189:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1189:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1189:Itgae UTSW 11 73115640 missense probably benign
Z1189:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1189:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1189:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1189:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1190:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1190:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1190:Itgae UTSW 11 73115640 missense probably benign
Z1190:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1190:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1190:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1190:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1191:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1191:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1191:Itgae UTSW 11 73115640 missense probably benign
Z1191:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1191:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1191:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1191:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1192:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1192:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1192:Itgae UTSW 11 73115640 missense probably benign
Z1192:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1192:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1192:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1192:Itgae UTSW 11 73134127 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- ACTTCCTCAGGGACAGTTCAC -3'
(R):5'- AGAACTGAACTGCCTTCCTTG -3'

Sequencing Primer
(F):5'- AGGGACAGTTCACCCCCAG -3'
(R):5'- GGGACTTAGACTCTGATAGCCTC -3'
Posted On2020-07-13