Incidental Mutation 'R8197:Supt16'
ID 635510
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Name suppressor of Ty 16
Synonyms Supt16h, Spt16, Fact140, Cdc68
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R8197 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 52160414-52197416 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 52174085 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 614 (P614S)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000046709
AA Change: P614S

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: P614S

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3010026O09Rik A G 11: 50,199,780 E257G probably benign Het
Aars T A 8: 111,053,996 D836E probably benign Het
Abca6 A C 11: 110,211,815 L861R probably damaging Het
Adamts18 G T 8: 113,754,595 A560E probably damaging Het
Adra2b A T 2: 127,364,658 Q365L possibly damaging Het
Anxa3 A G 5: 96,834,792 T250A probably benign Het
B4galt5 T A 2: 167,302,103 N309I probably benign Het
Bub1 G T 2: 127,801,257 R1056S probably damaging Het
Ccdc185 G T 1: 182,748,759 P122T possibly damaging Het
Cdk5rap3 A G 11: 96,916,149 probably null Het
Cntnap4 T A 8: 112,570,225 Y31N probably benign Het
Crygc T C 1: 65,073,206 M70V probably benign Het
Dnah14 A G 1: 181,690,101 E2000G possibly damaging Het
Dpp4 T C 2: 62,372,827 N266S probably benign Het
Edrf1 T A 7: 133,647,359 D304E probably benign Het
Fabp9 T G 3: 10,194,827 K42T probably benign Het
Fhl4 T A 10: 85,098,237 I227F probably damaging Het
Gm13941 T C 2: 111,096,576 probably null Het
Gm14124 A T 2: 150,267,657 H89L possibly damaging Het
Gsdmd T C 15: 75,864,337 I105T possibly damaging Het
Gys1 A G 7: 45,442,924 D317G possibly damaging Het
Hrh4 A G 18: 13,021,929 Y175C probably damaging Het
Igfals A G 17: 24,880,304 N123S probably benign Het
Igkv5-37 A G 6: 69,963,857 V2A possibly damaging Het
Iqsec3 A G 6: 121,413,012 L500P unknown Het
Itgae G A 11: 73,120,384 R660Q probably benign Het
Kcnip2 T C 19: 45,794,291 I204V possibly damaging Het
Kndc1 A G 7: 139,913,531 E471G probably damaging Het
Lrrtm3 T A 10: 64,088,516 T291S possibly damaging Het
Mast1 T A 8: 84,912,821 H1293L possibly damaging Het
Myo9b T C 8: 71,290,963 Y223H probably damaging Het
Nab1 G A 1: 52,489,968 R257* probably null Het
Ncapd3 C A 9: 27,086,033 L1217I probably damaging Het
Olfr186 T A 16: 59,027,085 D274V probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pde4d T A 13: 109,948,336 I489N probably damaging Het
Pdyn C T 2: 129,688,357 G131R probably benign Het
Qrich2 CACCTGCTTGCAACACACCAGGCTGAACTGGACCT CACCT 11: 116,457,035 probably benign Het
Rps6ka1 T C 4: 133,865,362 K276E possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Scube2 T A 7: 109,808,477 N752I possibly damaging Het
Scyl2 T C 10: 89,662,366 I194V probably benign Het
Sec31b T G 19: 44,524,516 R511S probably benign Het
Serpinb6d T C 13: 33,667,605 F115S probably damaging Het
Skint6 T G 4: 112,894,843 probably null Het
Tmem114 T C 16: 8,409,652 I182M probably damaging Het
Vmn1r125 G A 7: 21,272,926 V250I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp959 A T 17: 55,897,677 D238V probably damaging Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52161798 missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52161691 missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52183132 missense probably benign
IGL01328:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01329:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01413:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01414:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01535:Supt16 APN 14 52177190 missense probably damaging 0.99
IGL01765:Supt16 APN 14 52180223 missense probably damaging 0.98
IGL01976:Supt16 APN 14 52182307 missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52179543 missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52173806 missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52183964 missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52170878 missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52176398 missense probably damaging 0.98
IGL03406:Supt16 APN 14 52178141 missense possibly damaging 0.92
R7336_Supt16_529 UTSW 14 52171491 missense possibly damaging 0.93
watercolor UTSW 14 52170881 missense probably damaging 0.96
R0332:Supt16 UTSW 14 52181157 missense probably damaging 0.99
R0385:Supt16 UTSW 14 52176718 missense probably benign 0.01
R0389:Supt16 UTSW 14 52174113 missense probably damaging 0.98
R0422:Supt16 UTSW 14 52183996 missense probably benign 0.26
R1101:Supt16 UTSW 14 52171439 missense probably null 0.81
R1212:Supt16 UTSW 14 52174124 nonsense probably null
R1487:Supt16 UTSW 14 52176608 critical splice donor site probably null
R1494:Supt16 UTSW 14 52172459 missense probably benign 0.01
R1566:Supt16 UTSW 14 52176655 missense probably damaging 0.99
R1652:Supt16 UTSW 14 52177180 missense probably benign 0.34
R1913:Supt16 UTSW 14 52178135 missense possibly damaging 0.84
R2220:Supt16 UTSW 14 52172144 nonsense probably null
R2344:Supt16 UTSW 14 52178118 missense probably benign 0.00
R3430:Supt16 UTSW 14 52175359 missense probably benign 0.05
R3746:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R3749:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R4010:Supt16 UTSW 14 52164441 missense probably damaging 1.00
R4108:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4109:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4597:Supt16 UTSW 14 52173589 missense probably damaging 1.00
R5117:Supt16 UTSW 14 52183092 missense probably damaging 1.00
R5309:Supt16 UTSW 14 52162698 missense probably damaging 1.00
R5695:Supt16 UTSW 14 52174144 splice site probably null
R5895:Supt16 UTSW 14 52164522 missense probably benign 0.17
R5941:Supt16 UTSW 14 52182196 missense probably benign
R5993:Supt16 UTSW 14 52178334 missense probably damaging 1.00
R6197:Supt16 UTSW 14 52170881 missense probably damaging 0.96
R6254:Supt16 UTSW 14 52170834 missense probably damaging 1.00
R6381:Supt16 UTSW 14 52179546 missense probably benign 0.02
R6667:Supt16 UTSW 14 52172063 missense probably damaging 1.00
R7000:Supt16 UTSW 14 52171450 missense probably damaging 0.97
R7063:Supt16 UTSW 14 52172048 missense possibly damaging 0.92
R7276:Supt16 UTSW 14 52177001 missense probably benign
R7336:Supt16 UTSW 14 52171491 missense possibly damaging 0.93
R7344:Supt16 UTSW 14 52173571 missense probably damaging 0.98
R7384:Supt16 UTSW 14 52181162 missense probably damaging 0.99
R7411:Supt16 UTSW 14 52178051 missense probably damaging 1.00
R7586:Supt16 UTSW 14 52173556 missense probably damaging 0.97
R7633:Supt16 UTSW 14 52197099 missense probably benign 0.38
R8024:Supt16 UTSW 14 52170875 missense probably damaging 0.96
R8201:Supt16 UTSW 14 52170990 missense probably damaging 1.00
R8285:Supt16 UTSW 14 52181083 missense possibly damaging 0.95
R8508:Supt16 UTSW 14 52181589 missense probably damaging 1.00
R8531:Supt16 UTSW 14 52172563 missense probably damaging 0.98
R8797:Supt16 UTSW 14 52172503 missense probably damaging 0.99
R8872:Supt16 UTSW 14 52174087 missense probably benign 0.01
R9048:Supt16 UTSW 14 52181056 missense probably damaging 1.00
Z1177:Supt16 UTSW 14 52163285 missense possibly damaging 0.63
Z1177:Supt16 UTSW 14 52181537 missense probably null 0.21
Predicted Primers PCR Primer
(F):5'- AAACAGTGTGTGCATGGAGC -3'
(R):5'- AAAACATGTTAAGCCATCTGGG -3'

Sequencing Primer
(F):5'- GTGTGCATGGAGCCTTCATACC -3'
(R):5'- GAGGACCCTTGGAATTTGCTAACC -3'
Posted On 2020-07-13