Mutagenetix > Incidental Mutation

Incidental Mutation 'R8197:Vmn2r111'

635514

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R8197 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22559051 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 549 (N549S)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.7%

Validation Efficiency

96% (46/48)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3010026O09Rik	A	G	11: 50,199,780	E257G	probably benign	Het
Aars	T	A	8: 111,053,996	D836E	probably benign	Het
Abca6	A	C	11: 110,211,815	L861R	probably damaging	Het
Adamts18	G	T	8: 113,754,595	A560E	probably damaging	Het
Adra2b	A	T	2: 127,364,658	Q365L	possibly damaging	Het
Anxa3	A	G	5: 96,834,792	T250A	probably benign	Het
B4galt5	T	A	2: 167,302,103	N309I	probably benign	Het
Bub1	G	T	2: 127,801,257	R1056S	probably damaging	Het
Ccdc185	G	T	1: 182,748,759	P122T	possibly damaging	Het
Cdk5rap3	A	G	11: 96,916,149		probably null	Het
Cntnap4	T	A	8: 112,570,225	Y31N	probably benign	Het
Crygc	T	C	1: 65,073,206	M70V	probably benign	Het
Dnah14	A	G	1: 181,690,101	E2000G	possibly damaging	Het
Dpp4	T	C	2: 62,372,827	N266S	probably benign	Het
Edrf1	T	A	7: 133,647,359	D304E	probably benign	Het
Fabp9	T	G	3: 10,194,827	K42T	probably benign	Het
Fhl4	T	A	10: 85,098,237	I227F	probably damaging	Het
Gm13941	T	C	2: 111,096,576		probably null	Het
Gm14124	A	T	2: 150,267,657	H89L	possibly damaging	Het
Gsdmd	T	C	15: 75,864,337	I105T	possibly damaging	Het
Gys1	A	G	7: 45,442,924	D317G	possibly damaging	Het
Hrh4	A	G	18: 13,021,929	Y175C	probably damaging	Het
Igfals	A	G	17: 24,880,304	N123S	probably benign	Het
Igkv5-37	A	G	6: 69,963,857	V2A	possibly damaging	Het
Iqsec3	A	G	6: 121,413,012	L500P	unknown	Het
Itgae	G	A	11: 73,120,384	R660Q	probably benign	Het
Kcnip2	T	C	19: 45,794,291	I204V	possibly damaging	Het
Kndc1	A	G	7: 139,913,531	E471G	probably damaging	Het
Lrrtm3	T	A	10: 64,088,516	T291S	possibly damaging	Het
Mast1	T	A	8: 84,912,821	H1293L	possibly damaging	Het
Myo9b	T	C	8: 71,290,963	Y223H	probably damaging	Het
Nab1	G	A	1: 52,489,968	R257*	probably null	Het
Ncapd3	C	A	9: 27,086,033	L1217I	probably damaging	Het
Olfr186	T	A	16: 59,027,085	D274V	probably benign	Het
Olfr921	G	A	9: 38,775,281	V9M	noncoding transcript	Het
Pde4d	T	A	13: 109,948,336	I489N	probably damaging	Het
Pdyn	C	T	2: 129,688,357	G131R	probably benign	Het
Qrich2	CACCTGCTTGCAACACACCAGGCTGAACTGGACCT	CACCT	11: 116,457,035		probably benign	Het
Rps6ka1	T	C	4: 133,865,362	K276E	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,914		probably benign	Het
Scube2	T	A	7: 109,808,477	N752I	possibly damaging	Het
Scyl2	T	C	10: 89,662,366	I194V	probably benign	Het
Sec31b	T	G	19: 44,524,516	R511S	probably benign	Het
Serpinb6d	T	C	13: 33,667,605	F115S	probably damaging	Het
Skint6	T	G	4: 112,894,843		probably null	Het
Supt16	G	A	14: 52,174,085	P614S	possibly damaging	Het
Tmem114	T	C	16: 8,409,652	I182M	probably damaging	Het
Vmn1r125	G	A	7: 21,272,926	V250I	probably damaging	Het
Zfp959	A	T	17: 55,897,677	D238V	probably damaging	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22571841	missense	probably benign
R9374:Vmn2r111	UTSW	17	22568878	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22559151	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AAAGATGCAGCCCAATTTCTAC -3'
(R):5'- GGAGTTGGGAAACAATTCAACTTATCC -3'

Sequencing Primer
(F):5'- TGAGTAACTTAGGACAGAGAT -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'

Posted On

2020-07-13