Incidental Mutation 'R8198:Tmprss11g'
ID635531
Institutional Source Beutler Lab
Gene Symbol Tmprss11g
Ensembl Gene ENSMUSG00000079451
Gene Nametransmembrane protease, serine 11g
SynonymsDesc4, 9930032O22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R8198 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location86485876-86518600 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86498493 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 72 (F72I)
Ref Sequence ENSEMBL: ENSMUSP00000122709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134179] [ENSMUST00000140095]
Predicted Effect probably benign
Transcript: ENSMUST00000134179
AA Change: F72I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122709
Gene: ENSMUSG00000079451
AA Change: F72I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:SEA 48 150 1.5e-25 PFAM
Tryp_SPc 185 411 1.39e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140095
AA Change: F72I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115540
Gene: ENSMUSG00000079451
AA Change: F72I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:SEA 45 154 1.3e-19 PFAM
Tryp_SPc 172 398 1.39e-82 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik T C 14: 42,003,060 *168R probably null Het
Adgrb1 C A 15: 74,539,245 T330K probably damaging Het
AF366264 T A 8: 13,837,056 Y345F probably benign Het
AI481877 T C 4: 59,065,174 I814V probably benign Het
Ankrd27 T C 7: 35,608,455 V373A probably benign Het
Aoah C T 13: 20,917,120 P270L probably damaging Het
AU041133 C G 10: 82,151,415 P301A probably damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
Cd2bp2 A G 7: 127,194,404 S204P possibly damaging Het
Clca4b C A 3: 144,932,406 G32C probably damaging Het
Clcn2 A G 16: 20,707,196 V808A probably damaging Het
Clec4d T C 6: 123,268,006 C82R probably damaging Het
Dennd1c T C 17: 57,066,460 D671G possibly damaging Het
Eml5 G A 12: 98,858,886 R691* probably null Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gm11808 C A 4: 3,973,346 R72L probably benign Het
Gm4922 T C 10: 18,783,592 T461A probably benign Het
Gm9964 A G 11: 79,296,579 V14A unknown Het
Gnb3 T C 6: 124,837,037 Y196C probably benign Het
Hist1h4b C G 13: 23,757,300 Q94E possibly damaging Het
Hps1 C T 19: 42,767,220 R189Q probably benign Het
Iars2 G A 1: 185,297,506 T638I probably benign Het
Itpripl2 A G 7: 118,490,596 S247P probably damaging Het
Leng8 C A 7: 4,144,171 R523S possibly damaging Het
Lhfpl3 T A 5: 23,273,335 V72D probably benign Het
Lmntd2 A T 7: 141,211,221 M426K possibly damaging Het
Lsg1 A T 16: 30,564,776 V542E probably benign Het
Mphosph6 C T 8: 117,792,710 V108I probably benign Het
Mta2 A G 19: 8,947,781 T338A probably benign Het
Ncoa7 T C 10: 30,704,668 N98S probably benign Het
Olfr1352 C A 10: 78,984,609 T273K probably benign Het
Olfr652 T A 7: 104,564,933 D237E probably benign Het
Olfr8 T A 10: 78,955,724 V173E probably damaging Het
Pgr T C 9: 8,958,410 V806A possibly damaging Het
Rad54b T C 4: 11,612,440 probably null Het
Sdad1 A T 5: 92,291,952 C405S probably damaging Het
Smg1 T C 7: 118,145,606 I3108V probably benign Het
Spink5 A T 18: 43,992,880 I409F probably benign Het
Syt13 C A 2: 92,953,554 L390M probably damaging Het
Taf5 T A 19: 47,075,773 V385E probably damaging Het
Tdrd9 T A 12: 112,040,429 V909E probably damaging Het
Tex9 G A 9: 72,480,658 probably benign Het
Timm10b G T 7: 105,678,330 E61* probably null Het
Trank1 T C 9: 111,390,812 C2206R probably benign Het
Unc45b GC G 11: 82,925,988 probably null Het
Unc93b1 T C 19: 3,941,910 S215P possibly damaging Het
Usp48 C T 4: 137,621,159 probably benign Het
Vmn1r81 A G 7: 12,259,955 V242A possibly damaging Het
Zgrf1 T A 3: 127,596,024 probably null Het
Other mutations in Tmprss11g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Tmprss11g APN 5 86492191 missense probably benign 0.00
IGL01611:Tmprss11g APN 5 86490781 missense probably benign 0.02
IGL02417:Tmprss11g APN 5 86490891 missense probably benign 0.25
IGL02677:Tmprss11g APN 5 86492290 missense probably benign
IGL02832:Tmprss11g APN 5 86497269 missense probably benign 0.23
IGL02887:Tmprss11g APN 5 86497329 splice site probably benign
R0377:Tmprss11g UTSW 5 86490751 missense probably damaging 0.98
R0847:Tmprss11g UTSW 5 86490726 missense probably benign 0.01
R1037:Tmprss11g UTSW 5 86490747 missense probably damaging 1.00
R1507:Tmprss11g UTSW 5 86499611 missense probably benign 0.09
R1617:Tmprss11g UTSW 5 86499563 missense probably damaging 0.99
R1955:Tmprss11g UTSW 5 86498532 missense probably damaging 0.99
R2094:Tmprss11g UTSW 5 86499556 missense probably damaging 1.00
R2906:Tmprss11g UTSW 5 86492802 intron probably benign
R4730:Tmprss11g UTSW 5 86489232 nonsense probably null
R4730:Tmprss11g UTSW 5 86489233 missense probably damaging 1.00
R4934:Tmprss11g UTSW 5 86496542 missense probably benign
R4982:Tmprss11g UTSW 5 86492815 missense probably damaging 1.00
R5086:Tmprss11g UTSW 5 86496518 missense possibly damaging 0.65
R5606:Tmprss11g UTSW 5 86487410 missense probably damaging 1.00
R5825:Tmprss11g UTSW 5 86498533 missense probably damaging 0.98
R6291:Tmprss11g UTSW 5 86487422 missense probably damaging 1.00
R6481:Tmprss11g UTSW 5 86492156 missense probably benign 0.20
R6849:Tmprss11g UTSW 5 86496632 missense probably benign 0.01
R6925:Tmprss11g UTSW 5 86487426 missense probably benign 0.09
R6925:Tmprss11g UTSW 5 86487436 missense probably benign 0.00
R7084:Tmprss11g UTSW 5 86492200 missense probably damaging 1.00
R7089:Tmprss11g UTSW 5 86489291 missense probably damaging 0.97
R7190:Tmprss11g UTSW 5 86496632 missense probably benign 0.18
R7352:Tmprss11g UTSW 5 86496542 missense not run
R7432:Tmprss11g UTSW 5 86496507 missense possibly damaging 0.71
R7514:Tmprss11g UTSW 5 86497317 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCCTGTGTACTGCATATG -3'
(R):5'- ACCAAGTGTCCAACGTAGAAG -3'

Sequencing Primer
(F):5'- CTGTGTACTGCATATGTGTATTCAC -3'
(R):5'- CCAAGTGTCCAACGTAGAAGTTATC -3'
Posted On2020-07-13