Incidental Mutation 'R8198:Sdad1'
ID635532
Institutional Source Beutler Lab
Gene Symbol Sdad1
Ensembl Gene ENSMUSG00000029415
Gene NameSDA1 domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R8198 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location92284010-92310479 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92291952 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 405 (C405S)
Ref Sequence ENSEMBL: ENSMUSP00000031364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031364] [ENSMUST00000201143]
Predicted Effect probably damaging
Transcript: ENSMUST00000031364
AA Change: C405S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031364
Gene: ENSMUSG00000029415
AA Change: C405S

DomainStartEndE-ValueType
Pfam:NUC130_3NT 62 113 3.3e-28 PFAM
low complexity region 116 126 N/A INTRINSIC
low complexity region 146 163 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 254 278 N/A INTRINSIC
Pfam:SDA1 409 532 2.4e-41 PFAM
Pfam:SDA1 519 685 2.8e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201143
AA Change: C404S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144446
Gene: ENSMUSG00000029415
AA Change: C404S

DomainStartEndE-ValueType
Pfam:NUC130_3NT 62 113 5.3e-24 PFAM
low complexity region 116 126 N/A INTRINSIC
low complexity region 146 163 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 254 277 N/A INTRINSIC
Pfam:SDA1 408 531 3.9e-37 PFAM
Pfam:SDA1 518 684 4.6e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik T C 14: 42,003,060 *168R probably null Het
Adgrb1 C A 15: 74,539,245 T330K probably damaging Het
AF366264 T A 8: 13,837,056 Y345F probably benign Het
AI481877 T C 4: 59,065,174 I814V probably benign Het
Ankrd27 T C 7: 35,608,455 V373A probably benign Het
Aoah C T 13: 20,917,120 P270L probably damaging Het
AU041133 C G 10: 82,151,415 P301A probably damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
Cd2bp2 A G 7: 127,194,404 S204P possibly damaging Het
Clca4b C A 3: 144,932,406 G32C probably damaging Het
Clcn2 A G 16: 20,707,196 V808A probably damaging Het
Clec4d T C 6: 123,268,006 C82R probably damaging Het
Dennd1c T C 17: 57,066,460 D671G possibly damaging Het
Eml5 G A 12: 98,858,886 R691* probably null Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gm11808 C A 4: 3,973,346 R72L probably benign Het
Gm4922 T C 10: 18,783,592 T461A probably benign Het
Gm9964 A G 11: 79,296,579 V14A unknown Het
Gnb3 T C 6: 124,837,037 Y196C probably benign Het
Hist1h4b C G 13: 23,757,300 Q94E possibly damaging Het
Hps1 C T 19: 42,767,220 R189Q probably benign Het
Iars2 G A 1: 185,297,506 T638I probably benign Het
Itpripl2 A G 7: 118,490,596 S247P probably damaging Het
Leng8 C A 7: 4,144,171 R523S possibly damaging Het
Lhfpl3 T A 5: 23,273,335 V72D probably benign Het
Lmntd2 A T 7: 141,211,221 M426K possibly damaging Het
Lsg1 A T 16: 30,564,776 V542E probably benign Het
Mphosph6 C T 8: 117,792,710 V108I probably benign Het
Mta2 A G 19: 8,947,781 T338A probably benign Het
Ncoa7 T C 10: 30,704,668 N98S probably benign Het
Olfr1352 C A 10: 78,984,609 T273K probably benign Het
Olfr652 T A 7: 104,564,933 D237E probably benign Het
Olfr8 T A 10: 78,955,724 V173E probably damaging Het
Pgr T C 9: 8,958,410 V806A possibly damaging Het
Rad54b T C 4: 11,612,440 probably null Het
Smg1 T C 7: 118,145,606 I3108V probably benign Het
Spink5 A T 18: 43,992,880 I409F probably benign Het
Syt13 C A 2: 92,953,554 L390M probably damaging Het
Taf5 T A 19: 47,075,773 V385E probably damaging Het
Tdrd9 T A 12: 112,040,429 V909E probably damaging Het
Tex9 G A 9: 72,480,658 probably benign Het
Timm10b G T 7: 105,678,330 E61* probably null Het
Tmprss11g A T 5: 86,498,493 F72I probably benign Het
Trank1 T C 9: 111,390,812 C2206R probably benign Het
Unc45b GC G 11: 82,925,988 probably null Het
Unc93b1 T C 19: 3,941,910 S215P possibly damaging Het
Usp48 C T 4: 137,621,159 probably benign Het
Vmn1r81 A G 7: 12,259,955 V242A possibly damaging Het
Zgrf1 T A 3: 127,596,024 probably null Het
Other mutations in Sdad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Sdad1 APN 5 92303773 splice site probably null
IGL01355:Sdad1 APN 5 92302679 missense probably damaging 1.00
IGL01635:Sdad1 APN 5 92297160 missense probably damaging 0.98
IGL02166:Sdad1 APN 5 92291762 missense probably benign 0.03
IGL02503:Sdad1 APN 5 92301802 unclassified probably benign
IGL02739:Sdad1 APN 5 92290072 missense probably benign 0.43
PIT4468001:Sdad1 UTSW 5 92291918 missense probably damaging 1.00
R0583:Sdad1 UTSW 5 92305064 missense probably damaging 0.97
R1169:Sdad1 UTSW 5 92298233 missense probably benign 0.32
R1496:Sdad1 UTSW 5 92309823 missense possibly damaging 0.94
R1844:Sdad1 UTSW 5 92305296 nonsense probably null
R1848:Sdad1 UTSW 5 92292651 critical splice donor site probably null
R2419:Sdad1 UTSW 5 92305818 missense possibly damaging 0.69
R2497:Sdad1 UTSW 5 92300099 missense probably benign 0.00
R2509:Sdad1 UTSW 5 92305825 missense probably benign 0.12
R4043:Sdad1 UTSW 5 92302694 missense probably damaging 0.96
R4384:Sdad1 UTSW 5 92298257 missense probably benign 0.01
R4477:Sdad1 UTSW 5 92297160 missense probably damaging 0.98
R4478:Sdad1 UTSW 5 92297160 missense probably damaging 0.98
R4734:Sdad1 UTSW 5 92304977 missense possibly damaging 0.61
R4749:Sdad1 UTSW 5 92304977 missense possibly damaging 0.61
R5135:Sdad1 UTSW 5 92303934 missense probably benign 0.00
R5288:Sdad1 UTSW 5 92286825 makesense probably null
R6331:Sdad1 UTSW 5 92303930 missense probably damaging 1.00
R7038:Sdad1 UTSW 5 92298190 critical splice donor site probably null
R7099:Sdad1 UTSW 5 92293973 missense possibly damaging 0.89
R7420:Sdad1 UTSW 5 92305737 missense possibly damaging 0.91
R7425:Sdad1 UTSW 5 92300121 missense probably benign 0.10
R7714:Sdad1 UTSW 5 92302679 missense probably damaging 1.00
R8048:Sdad1 UTSW 5 92300089 missense probably benign 0.01
R8347:Sdad1 UTSW 5 92298229 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCTGAGGGTTCAATGTCCGG -3'
(R):5'- GTCAGAGGAAGTGCAACTGTTG -3'

Sequencing Primer
(F):5'- TGGATCAAAGTCCTGGCAGACATC -3'
(R):5'- CAACTGTTGGGAATGTCAGTC -3'
Posted On2020-07-13