Incidental Mutation 'R8198:Gnb3'
ID635534
Institutional Source Beutler Lab
Gene Symbol Gnb3
Ensembl Gene ENSMUSG00000023439
Gene Nameguanine nucleotide binding protein (G protein), beta 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8198 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location124834240-124840275 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124837037 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 196 (Y196C)
Ref Sequence ENSEMBL: ENSMUSP00000024206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023958] [ENSMUST00000024206] [ENSMUST00000024270] [ENSMUST00000131847] [ENSMUST00000135127] [ENSMUST00000150120] [ENSMUST00000151674]
Predicted Effect probably benign
Transcript: ENSMUST00000023958
SMART Domains Protein: ENSMUSP00000023958
Gene: ENSMUSG00000023191

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
P4Hc 460 670 8.51e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000024206
AA Change: Y196C

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000024206
Gene: ENSMUSG00000023439
AA Change: Y196C

DomainStartEndE-ValueType
WD40 44 83 4.91e-8 SMART
WD40 86 125 1.61e-3 SMART
WD40 132 170 5.1e-6 SMART
WD40 173 212 3.99e-8 SMART
WD40 215 254 2.67e-9 SMART
WD40 263 298 2e-1 SMART
WD40 301 340 3.87e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000024270
Predicted Effect probably benign
Transcript: ENSMUST00000131847
Predicted Effect probably benign
Transcript: ENSMUST00000135127
SMART Domains Protein: ENSMUSP00000116338
Gene: ENSMUSG00000023191

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150120
Predicted Effect probably benign
Transcript: ENSMUST00000151674
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit which belongs to the WD repeat G protein beta family. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. A single-nucleotide polymorphism (C825T) in this gene is associated with essential hypertension and obesity. This polymorphism is also associated with the occurrence of the splice variant GNB3-s, which appears to have increased activity. GNB3-s is an example of alternative splicing caused by a nucleotide change outside of the splice donor and acceptor sites. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal light ON response and synaptic maintenance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik T C 14: 42,003,060 *168R probably null Het
Adgrb1 C A 15: 74,539,245 T330K probably damaging Het
AF366264 T A 8: 13,837,056 Y345F probably benign Het
AI481877 T C 4: 59,065,174 I814V probably benign Het
Ankrd27 T C 7: 35,608,455 V373A probably benign Het
Aoah C T 13: 20,917,120 P270L probably damaging Het
AU041133 C G 10: 82,151,415 P301A probably damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
Cd2bp2 A G 7: 127,194,404 S204P possibly damaging Het
Clca4b C A 3: 144,932,406 G32C probably damaging Het
Clcn2 A G 16: 20,707,196 V808A probably damaging Het
Clec4d T C 6: 123,268,006 C82R probably damaging Het
Dennd1c T C 17: 57,066,460 D671G possibly damaging Het
Eml5 G A 12: 98,858,886 R691* probably null Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gm11808 C A 4: 3,973,346 R72L probably benign Het
Gm4922 T C 10: 18,783,592 T461A probably benign Het
Gm9964 A G 11: 79,296,579 V14A unknown Het
Hist1h4b C G 13: 23,757,300 Q94E possibly damaging Het
Hps1 C T 19: 42,767,220 R189Q probably benign Het
Iars2 G A 1: 185,297,506 T638I probably benign Het
Itpripl2 A G 7: 118,490,596 S247P probably damaging Het
Leng8 C A 7: 4,144,171 R523S possibly damaging Het
Lhfpl3 T A 5: 23,273,335 V72D probably benign Het
Lmntd2 A T 7: 141,211,221 M426K possibly damaging Het
Lsg1 A T 16: 30,564,776 V542E probably benign Het
Mphosph6 C T 8: 117,792,710 V108I probably benign Het
Mta2 A G 19: 8,947,781 T338A probably benign Het
Ncoa7 T C 10: 30,704,668 N98S probably benign Het
Olfr1352 C A 10: 78,984,609 T273K probably benign Het
Olfr652 T A 7: 104,564,933 D237E probably benign Het
Olfr8 T A 10: 78,955,724 V173E probably damaging Het
Pgr T C 9: 8,958,410 V806A possibly damaging Het
Rad54b T C 4: 11,612,440 probably null Het
Sdad1 A T 5: 92,291,952 C405S probably damaging Het
Smg1 T C 7: 118,145,606 I3108V probably benign Het
Spink5 A T 18: 43,992,880 I409F probably benign Het
Syt13 C A 2: 92,953,554 L390M probably damaging Het
Taf5 T A 19: 47,075,773 V385E probably damaging Het
Tdrd9 T A 12: 112,040,429 V909E probably damaging Het
Tex9 G A 9: 72,480,658 probably benign Het
Timm10b G T 7: 105,678,330 E61* probably null Het
Tmprss11g A T 5: 86,498,493 F72I probably benign Het
Trank1 T C 9: 111,390,812 C2206R probably benign Het
Unc45b GC G 11: 82,925,988 probably null Het
Unc93b1 T C 19: 3,941,910 S215P possibly damaging Het
Usp48 C T 4: 137,621,159 probably benign Het
Vmn1r81 A G 7: 12,259,955 V242A possibly damaging Het
Zgrf1 T A 3: 127,596,024 probably null Het
Other mutations in Gnb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Gnb3 APN 6 124837255 missense probably damaging 0.98
IGL01707:Gnb3 APN 6 124839689 missense possibly damaging 0.56
IGL02412:Gnb3 APN 6 124837462 missense probably benign 0.23
IGL02606:Gnb3 APN 6 124837415 missense probably benign 0.01
IGL02627:Gnb3 APN 6 124834715 missense probably damaging 0.98
IGL02669:Gnb3 APN 6 124837725 missense probably benign 0.17
R0006:Gnb3 UTSW 6 124835804 unclassified probably benign
R0026:Gnb3 UTSW 6 124837417 missense probably benign 0.00
R0445:Gnb3 UTSW 6 124837255 missense possibly damaging 0.92
R0538:Gnb3 UTSW 6 124835696 nonsense probably null
R1801:Gnb3 UTSW 6 124835636 missense probably benign 0.13
R4074:Gnb3 UTSW 6 124836979 missense probably benign
R6715:Gnb3 UTSW 6 124837728 missense possibly damaging 0.94
R7146:Gnb3 UTSW 6 124836924 critical splice donor site probably null
R7689:Gnb3 UTSW 6 124837220 missense possibly damaging 0.82
R7884:Gnb3 UTSW 6 124837092 missense probably benign 0.00
X0017:Gnb3 UTSW 6 124837068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACCTAAGTGTGACTGAGTGG -3'
(R):5'- ATGGTAAGGGTTGAATGCCC -3'

Sequencing Primer
(F):5'- GGCTTTGAAACTCTCCTACAAGG -3'
(R):5'- TTGAATGCCCCGGGAGCTG -3'
Posted On2020-07-13