Incidental Mutation 'R8198:Or7a42'
ID 635551
Institutional Source Beutler Lab
Gene Symbol Or7a42
Ensembl Gene ENSMUSG00000094080
Gene Name olfactory receptor family 7 subfamily A member 42
Synonyms GA_x6K02T2QGN0-2857086-2856154, MOR139-5P, Olfr8
MMRRC Submission 067621-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.143) question?
Stock # R8198 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 78791041-78791973 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78791558 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 173 (V173E)
Ref Sequence ENSEMBL: ENSMUSP00000144916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081571] [ENSMUST00000203851]
AlphaFold Q60892
Predicted Effect probably damaging
Transcript: ENSMUST00000081571
AA Change: V173E

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080282
Gene: ENSMUSG00000094080
AA Change: V173E

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.3e-47 PFAM
Pfam:7tm_1 42 291 3e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203851
AA Change: V173E

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144916
Gene: ENSMUSG00000094080
AA Change: V173E

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.3e-47 PFAM
Pfam:7tm_1 42 291 3e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik T C 14: 41,825,017 (GRCm39) *168R probably null Het
Adgrb1 C A 15: 74,411,094 (GRCm39) T330K probably damaging Het
Ankrd27 T C 7: 35,307,880 (GRCm39) V373A probably benign Het
Aoah C T 13: 21,101,290 (GRCm39) P270L probably damaging Het
AU041133 C G 10: 81,987,249 (GRCm39) P301A probably damaging Het
Aven C T 2: 112,390,120 (GRCm39) R8W probably benign Het
Cd2bp2 A G 7: 126,793,576 (GRCm39) S204P possibly damaging Het
Clca4b C A 3: 144,638,167 (GRCm39) G32C probably damaging Het
Clcn2 A G 16: 20,525,946 (GRCm39) V808A probably damaging Het
Clec4d T C 6: 123,244,965 (GRCm39) C82R probably damaging Het
Dennd1c T C 17: 57,373,460 (GRCm39) D671G possibly damaging Het
Eml5 G A 12: 98,825,145 (GRCm39) R691* probably null Het
Fcnb C T 2: 27,968,330 (GRCm39) S209N possibly damaging Het
Gm4922 T C 10: 18,659,340 (GRCm39) T461A probably benign Het
Gm9964 A G 11: 79,187,405 (GRCm39) V14A unknown Het
Gnb3 T C 6: 124,814,000 (GRCm39) Y196C probably benign Het
H4c2 C G 13: 23,941,283 (GRCm39) Q94E possibly damaging Het
Hps1 C T 19: 42,755,659 (GRCm39) R189Q probably benign Het
Iars2 G A 1: 185,029,703 (GRCm39) T638I probably benign Het
Itpripl2 A G 7: 118,089,819 (GRCm39) S247P probably damaging Het
Leng8 C A 7: 4,147,170 (GRCm39) R523S possibly damaging Het
Lhfpl3 T A 5: 23,478,333 (GRCm39) V72D probably benign Het
Lmntd2 A T 7: 140,791,134 (GRCm39) M426K possibly damaging Het
Lsg1 A T 16: 30,383,594 (GRCm39) V542E probably benign Het
Mphosph6 C T 8: 118,519,449 (GRCm39) V108I probably benign Het
Mta2 A G 19: 8,925,145 (GRCm39) T338A probably benign Het
Ncoa7 T C 10: 30,580,664 (GRCm39) N98S probably benign Het
Or52h7 T A 7: 104,214,140 (GRCm39) D237E probably benign Het
Or7a36 C A 10: 78,820,443 (GRCm39) T273K probably benign Het
Pgr T C 9: 8,958,411 (GRCm39) V806A possibly damaging Het
Rad54b T C 4: 11,612,440 (GRCm39) probably null Het
Sdad1 A T 5: 92,439,811 (GRCm39) C405S probably damaging Het
Semp2l2a T A 8: 13,887,056 (GRCm39) Y345F probably benign Het
Shoc1 T C 4: 59,065,174 (GRCm39) I814V probably benign Het
Smg1 T C 7: 117,744,829 (GRCm39) I3108V probably benign Het
Spink5 A T 18: 44,125,947 (GRCm39) I409F probably benign Het
Syt13 C A 2: 92,783,899 (GRCm39) L390M probably damaging Het
Taf5 T A 19: 47,064,212 (GRCm39) V385E probably damaging Het
Tdrd9 T A 12: 112,006,863 (GRCm39) V909E probably damaging Het
Tex9 G A 9: 72,387,940 (GRCm39) probably benign Het
Timm10b G T 7: 105,327,537 (GRCm39) E61* probably null Het
Tmprss11g A T 5: 86,646,352 (GRCm39) F72I probably benign Het
Trank1 T C 9: 111,219,880 (GRCm39) C2206R probably benign Het
Uba52rt C A 4: 3,973,346 (GRCm39) R72L probably benign Het
Unc45b GC G 11: 82,816,814 (GRCm39) probably null Het
Unc93b1 T C 19: 3,991,910 (GRCm39) S215P possibly damaging Het
Usp48 C T 4: 137,348,470 (GRCm39) probably benign Het
Vmn1r81 A G 7: 11,993,882 (GRCm39) V242A possibly damaging Het
Zgrf1 T A 3: 127,389,673 (GRCm39) probably null Het
Other mutations in Or7a42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Or7a42 APN 10 78,791,188 (GRCm39) missense possibly damaging 0.48
IGL01480:Or7a42 APN 10 78,791,978 (GRCm39) utr 3 prime probably benign
IGL02505:Or7a42 APN 10 78,791,767 (GRCm39) missense probably benign 0.02
IGL02543:Or7a42 APN 10 78,791,773 (GRCm39) missense probably damaging 1.00
IGL03323:Or7a42 APN 10 78,791,434 (GRCm39) missense probably benign
PIT4466001:Or7a42 UTSW 10 78,791,676 (GRCm39) missense probably benign 0.00
R1496:Or7a42 UTSW 10 78,791,682 (GRCm39) missense probably benign 0.41
R1754:Or7a42 UTSW 10 78,791,531 (GRCm39) missense probably damaging 0.99
R1878:Or7a42 UTSW 10 78,791,639 (GRCm39) missense possibly damaging 0.62
R2760:Or7a42 UTSW 10 78,791,876 (GRCm39) missense probably damaging 0.99
R4202:Or7a42 UTSW 10 78,791,129 (GRCm39) missense probably benign
R4206:Or7a42 UTSW 10 78,791,117 (GRCm39) missense probably benign 0.00
R4517:Or7a42 UTSW 10 78,791,877 (GRCm39) nonsense probably null
R4613:Or7a42 UTSW 10 78,791,899 (GRCm39) missense probably damaging 1.00
R4799:Or7a42 UTSW 10 78,791,931 (GRCm39) missense probably null 0.92
R4979:Or7a42 UTSW 10 78,791,766 (GRCm39) nonsense probably null
R5008:Or7a42 UTSW 10 78,791,905 (GRCm39) missense probably damaging 1.00
R5700:Or7a42 UTSW 10 78,791,318 (GRCm39) missense probably damaging 1.00
R5876:Or7a42 UTSW 10 78,791,191 (GRCm39) missense probably benign 0.15
R6439:Or7a42 UTSW 10 78,791,818 (GRCm39) missense probably damaging 1.00
R6930:Or7a42 UTSW 10 78,791,615 (GRCm39) missense possibly damaging 0.84
R7110:Or7a42 UTSW 10 78,791,284 (GRCm39) missense possibly damaging 0.83
R7405:Or7a42 UTSW 10 78,791,531 (GRCm39) missense probably benign 0.14
R7524:Or7a42 UTSW 10 78,791,325 (GRCm39) nonsense probably null
R9227:Or7a42 UTSW 10 78,791,929 (GRCm39) missense possibly damaging 0.92
R9230:Or7a42 UTSW 10 78,791,929 (GRCm39) missense possibly damaging 0.92
Z1176:Or7a42 UTSW 10 78,791,053 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGATGTCTGTCTTCTTGG -3'
(R):5'- ATGCCGTGTACTTCCCTTGAAC -3'

Sequencing Primer
(F):5'- GCAGAATTGGACAACTTTCTCCTGG -3'
(R):5'- CTTCCCTTGAACTGAGGAGATAG -3'
Posted On 2020-07-13