Incidental Mutation 'R8198:Eml5'
ID 635556
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Name echinoderm microtubule associated protein like 5
Synonyms C130068M19Rik
MMRRC Submission 067621-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.237) question?
Stock # R8198 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 98786805-98901484 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 98858886 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 691 (R691*)
Ref Sequence ENSEMBL: ENSMUSP00000065643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065716]
AlphaFold Q8BQM8
Predicted Effect probably null
Transcript: ENSMUST00000065716
AA Change: R691*
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: R691*

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik T C 14: 42,003,060 *168R probably null Het
Adgrb1 C A 15: 74,539,245 T330K probably damaging Het
AF366264 T A 8: 13,837,056 Y345F probably benign Het
AI481877 T C 4: 59,065,174 I814V probably benign Het
Ankrd27 T C 7: 35,608,455 V373A probably benign Het
Aoah C T 13: 20,917,120 P270L probably damaging Het
AU041133 C G 10: 82,151,415 P301A probably damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
Cd2bp2 A G 7: 127,194,404 S204P possibly damaging Het
Clca4b C A 3: 144,932,406 G32C probably damaging Het
Clcn2 A G 16: 20,707,196 V808A probably damaging Het
Clec4d T C 6: 123,268,006 C82R probably damaging Het
Dennd1c T C 17: 57,066,460 D671G possibly damaging Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gm11808 C A 4: 3,973,346 R72L probably benign Het
Gm4922 T C 10: 18,783,592 T461A probably benign Het
Gm9964 A G 11: 79,296,579 V14A unknown Het
Gnb3 T C 6: 124,837,037 Y196C probably benign Het
Hist1h4b C G 13: 23,757,300 Q94E possibly damaging Het
Hps1 C T 19: 42,767,220 R189Q probably benign Het
Iars2 G A 1: 185,297,506 T638I probably benign Het
Itpripl2 A G 7: 118,490,596 S247P probably damaging Het
Leng8 C A 7: 4,144,171 R523S possibly damaging Het
Lhfpl3 T A 5: 23,273,335 V72D probably benign Het
Lmntd2 A T 7: 141,211,221 M426K possibly damaging Het
Lsg1 A T 16: 30,564,776 V542E probably benign Het
Mphosph6 C T 8: 117,792,710 V108I probably benign Het
Mta2 A G 19: 8,947,781 T338A probably benign Het
Ncoa7 T C 10: 30,704,668 N98S probably benign Het
Olfr1352 C A 10: 78,984,609 T273K probably benign Het
Olfr652 T A 7: 104,564,933 D237E probably benign Het
Olfr8 T A 10: 78,955,724 V173E probably damaging Het
Pgr T C 9: 8,958,410 V806A possibly damaging Het
Rad54b T C 4: 11,612,440 probably null Het
Sdad1 A T 5: 92,291,952 C405S probably damaging Het
Smg1 T C 7: 118,145,606 I3108V probably benign Het
Spink5 A T 18: 43,992,880 I409F probably benign Het
Syt13 C A 2: 92,953,554 L390M probably damaging Het
Taf5 T A 19: 47,075,773 V385E probably damaging Het
Tdrd9 T A 12: 112,040,429 V909E probably damaging Het
Tex9 G A 9: 72,480,658 probably benign Het
Timm10b G T 7: 105,678,330 E61* probably null Het
Tmprss11g A T 5: 86,498,493 F72I probably benign Het
Trank1 T C 9: 111,390,812 C2206R probably benign Het
Unc45b GC G 11: 82,925,988 probably null Het
Unc93b1 T C 19: 3,941,910 S215P possibly damaging Het
Usp48 C T 4: 137,621,159 probably benign Het
Vmn1r81 A G 7: 12,259,955 V242A possibly damaging Het
Zgrf1 T A 3: 127,596,024 probably null Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98873209 splice site probably benign
IGL00473:Eml5 APN 12 98805492 splice site probably benign
IGL01120:Eml5 APN 12 98844019 missense probably benign
IGL01308:Eml5 APN 12 98802313 missense probably damaging 1.00
IGL01790:Eml5 APN 12 98798932 missense probably damaging 1.00
IGL01973:Eml5 APN 12 98863280 missense probably benign
IGL02182:Eml5 APN 12 98802322 missense probably damaging 1.00
IGL02201:Eml5 APN 12 98794424 splice site probably benign
IGL02375:Eml5 APN 12 98844087 missense probably damaging 1.00
IGL02397:Eml5 APN 12 98790674 missense probably benign 0.07
IGL02480:Eml5 APN 12 98876243 missense probably damaging 1.00
IGL02801:Eml5 APN 12 98817845 missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98858841 missense probably damaging 1.00
IGL03104:Eml5 APN 12 98861245 nonsense probably null
IGL03158:Eml5 APN 12 98827514 splice site probably benign
IGL03286:Eml5 APN 12 98860503 missense probably damaging 1.00
IGL03380:Eml5 APN 12 98874647 splice site probably benign
BB010:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
BB020:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
R0573:Eml5 UTSW 12 98824772 splice site probably null
R0624:Eml5 UTSW 12 98865479 missense probably damaging 1.00
R0993:Eml5 UTSW 12 98861183 missense probably benign 0.25
R1073:Eml5 UTSW 12 98830973 missense probably damaging 1.00
R1183:Eml5 UTSW 12 98792046 missense probably benign 0.31
R1352:Eml5 UTSW 12 98831003 splice site probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1503:Eml5 UTSW 12 98831174 missense probably damaging 0.99
R1538:Eml5 UTSW 12 98794276 missense probably damaging 0.99
R1689:Eml5 UTSW 12 98830935 missense probably damaging 1.00
R1773:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1775:Eml5 UTSW 12 98852704 splice site probably null
R1791:Eml5 UTSW 12 98887056 missense probably benign 0.31
R1856:Eml5 UTSW 12 98810584 missense probably damaging 1.00
R1919:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1957:Eml5 UTSW 12 98859961 missense probably damaging 1.00
R1962:Eml5 UTSW 12 98876311 missense probably damaging 0.99
R2033:Eml5 UTSW 12 98791386 missense possibly damaging 0.71
R2035:Eml5 UTSW 12 98794266 missense probably benign 0.33
R2073:Eml5 UTSW 12 98802446 missense probably damaging 0.99
R2143:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2144:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2158:Eml5 UTSW 12 98843946 splice site probably benign
R2164:Eml5 UTSW 12 98887097 missense probably damaging 0.99
R2175:Eml5 UTSW 12 98876223 nonsense probably null
R2200:Eml5 UTSW 12 98825417 missense probably damaging 1.00
R2234:Eml5 UTSW 12 98841581 missense probably damaging 1.00
R2504:Eml5 UTSW 12 98844105 missense possibly damaging 0.71
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2958:Eml5 UTSW 12 98876178 missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98880808 splice site probably null
R3118:Eml5 UTSW 12 98865494 missense probably damaging 0.97
R3735:Eml5 UTSW 12 98855989 missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98816024 missense probably damaging 1.00
R3900:Eml5 UTSW 12 98825523 missense probably damaging 1.00
R3973:Eml5 UTSW 12 98802465 splice site probably benign
R3976:Eml5 UTSW 12 98802465 splice site probably benign
R4105:Eml5 UTSW 12 98841548 splice site probably null
R4107:Eml5 UTSW 12 98841548 splice site probably null
R4108:Eml5 UTSW 12 98841548 splice site probably null
R4109:Eml5 UTSW 12 98841548 splice site probably null
R4258:Eml5 UTSW 12 98865434 missense probably benign 0.01
R4381:Eml5 UTSW 12 98815955 missense possibly damaging 0.93
R4590:Eml5 UTSW 12 98837341 missense possibly damaging 0.91
R4737:Eml5 UTSW 12 98798852 missense probably damaging 1.00
R4775:Eml5 UTSW 12 98802307 missense probably benign 0.05
R4850:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5007:Eml5 UTSW 12 98830965 missense probably damaging 1.00
R5092:Eml5 UTSW 12 98792616 missense probably damaging 1.00
R5123:Eml5 UTSW 12 98874512 missense probably damaging 1.00
R5124:Eml5 UTSW 12 98792042 missense probably damaging 1.00
R5273:Eml5 UTSW 12 98790688 missense probably damaging 1.00
R5369:Eml5 UTSW 12 98858783 missense probably damaging 1.00
R5430:Eml5 UTSW 12 98794158 missense probably damaging 1.00
R5748:Eml5 UTSW 12 98825555 missense probably damaging 0.99
R5769:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5832:Eml5 UTSW 12 98876188 missense probably benign
R6113:Eml5 UTSW 12 98824674 nonsense probably null
R6131:Eml5 UTSW 12 98861251 missense probably damaging 0.99
R6175:Eml5 UTSW 12 98794456 missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98863129 missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98870884 missense probably damaging 0.98
R6375:Eml5 UTSW 12 98798868
R6528:Eml5 UTSW 12 98824637 missense probably benign 0.18
R6657:Eml5 UTSW 12 98791405 missense probably damaging 0.98
R6717:Eml5 UTSW 12 98827506 missense probably damaging 1.00
R6751:Eml5 UTSW 12 98865400 missense probably damaging 1.00
R6833:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6834:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6972:Eml5 UTSW 12 98876180 missense probably benign 0.00
R7091:Eml5 UTSW 12 98802474 missense probably benign 0.16
R7353:Eml5 UTSW 12 98825424 missense
R7644:Eml5 UTSW 12 98855944 missense probably benign 0.05
R7694:Eml5 UTSW 12 98792563 missense probably damaging 0.99
R7842:Eml5 UTSW 12 98794135 missense probably damaging 1.00
R7933:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
R8111:Eml5 UTSW 12 98792514 critical splice donor site probably null
R8482:Eml5 UTSW 12 98876301 missense probably damaging 1.00
R8732:Eml5 UTSW 12 98815959 missense probably damaging 0.99
R8956:Eml5 UTSW 12 98852693 missense possibly damaging 0.69
R8975:Eml5 UTSW 12 98810570 missense probably damaging 0.99
R9131:Eml5 UTSW 12 98858840 missense probably damaging 1.00
R9258:Eml5 UTSW 12 98844117 missense possibly damaging 0.77
R9261:Eml5 UTSW 12 98856028 missense probably damaging 0.99
R9276:Eml5 UTSW 12 98798801 missense probably damaging 0.99
R9301:Eml5 UTSW 12 98882033 nonsense probably null
R9368:Eml5 UTSW 12 98796578 missense probably benign 0.31
R9392:Eml5 UTSW 12 98900940 missense probably damaging 1.00
R9393:Eml5 UTSW 12 98876174 missense probably benign 0.35
R9449:Eml5 UTSW 12 98861295 missense probably damaging 1.00
R9570:Eml5 UTSW 12 98815984 missense probably benign 0.15
T0722:Eml5 UTSW 12 98841582 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AACTTACCTGGCCTGTTGC -3'
(R):5'- ACTCAGTACCTTAGCCTAGATTTAGC -3'

Sequencing Primer
(F):5'- CTGTTGCCACATAGTCTTTCAAAGG -3'
(R):5'- AGCTATCTGTAATCTGAGAAGCTC -3'
Posted On 2020-07-13