Mutagenetix > Incidental Mutation

Incidental Mutation 'R8198:Adgrb1'

635561

Institutional Source

Beutler Lab

Gene Symbol

Adgrb1

Ensembl Gene

ENSMUSG00000034730

Gene Name

adhesion G protein-coupled receptor B1

Synonyms

Bai1, B830018M07Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8198 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74516195-74589465 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 74539245 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 330 (T330K)

Ref Sequence

ENSEMBL: ENSMUSP00000046097 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042035] [ENSMUST00000186360] [ENSMUST00000187485]

AlphaFold

Q3UHD1

Predicted Effect

probably damaging
Transcript: ENSMUST00000042035
AA Change: T330K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000046097
Gene: ENSMUSG00000034730
AA Change: T330K

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	4.69e-10	SMART
low complexity region	319	329	N/A	INTRINSIC
TSP1	357	407	3.5e-9	SMART
TSP1	412	462	3.16e-16	SMART
TSP1	470	520	7.15e-15	SMART
TSP1	525	575	3.11e-15	SMART
HormR	577	643	2.55e-20	SMART
Pfam:GAIN	656	859	1e-46	PFAM
GPS	880	938	1.46e-18	SMART
Pfam:7tm_2	944	1180	3.3e-66	PFAM
SCOP:d1jvr__	1396	1432	5e-4	SMART
low complexity region	1441	1455	N/A	INTRINSIC
low complexity region	1545	1556	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000186360
AA Change: T330K

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000140362
Gene: ENSMUSG00000034730
AA Change: T330K

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	2.2e-12	SMART
low complexity region	319	329	N/A	INTRINSIC
TSP1	357	407	1.7e-11	SMART
TSP1	412	462	1.5e-18	SMART
TSP1	470	520	3.4e-17	SMART
TSP1	525	575	1.5e-17	SMART
HormR	577	643	1.6e-22	SMART
Pfam:DUF3497	653	874	1.2e-44	PFAM
GPS	880	938	8.9e-21	SMART
Pfam:7tm_2	944	1106	9.6e-43	PFAM
low complexity region	1113	1143	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000187485
AA Change: T330K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140959
Gene: ENSMUSG00000034730
AA Change: T330K

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	2.2e-12	SMART
low complexity region	319	329	N/A	INTRINSIC
low complexity region	371	386	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189200

Meta Mutation Damage Score

0.0860

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024B05Rik	T	C	14: 42,003,060	*168R	probably null	Het
AF366264	T	A	8: 13,837,056	Y345F	probably benign	Het
AI481877	T	C	4: 59,065,174	I814V	probably benign	Het
Ankrd27	T	C	7: 35,608,455	V373A	probably benign	Het
Aoah	C	T	13: 20,917,120	P270L	probably damaging	Het
AU041133	C	G	10: 82,151,415	P301A	probably damaging	Het
Aven	C	T	2: 112,559,775	R8W	probably benign	Het
Cd2bp2	A	G	7: 127,194,404	S204P	possibly damaging	Het
Clca4b	C	A	3: 144,932,406	G32C	probably damaging	Het
Clcn2	A	G	16: 20,707,196	V808A	probably damaging	Het
Clec4d	T	C	6: 123,268,006	C82R	probably damaging	Het
Dennd1c	T	C	17: 57,066,460	D671G	possibly damaging	Het
Eml5	G	A	12: 98,858,886	R691*	probably null	Het
Fcnb	C	T	2: 28,078,318	S209N	possibly damaging	Het
Gm11808	C	A	4: 3,973,346	R72L	probably benign	Het
Gm4922	T	C	10: 18,783,592	T461A	probably benign	Het
Gm9964	A	G	11: 79,296,579	V14A	unknown	Het
Gnb3	T	C	6: 124,837,037	Y196C	probably benign	Het
Hist1h4b	C	G	13: 23,757,300	Q94E	possibly damaging	Het
Hps1	C	T	19: 42,767,220	R189Q	probably benign	Het
Iars2	G	A	1: 185,297,506	T638I	probably benign	Het
Itpripl2	A	G	7: 118,490,596	S247P	probably damaging	Het
Leng8	C	A	7: 4,144,171	R523S	possibly damaging	Het
Lhfpl3	T	A	5: 23,273,335	V72D	probably benign	Het
Lmntd2	A	T	7: 141,211,221	M426K	possibly damaging	Het
Lsg1	A	T	16: 30,564,776	V542E	probably benign	Het
Mphosph6	C	T	8: 117,792,710	V108I	probably benign	Het
Mta2	A	G	19: 8,947,781	T338A	probably benign	Het
Ncoa7	T	C	10: 30,704,668	N98S	probably benign	Het
Olfr1352	C	A	10: 78,984,609	T273K	probably benign	Het
Olfr652	T	A	7: 104,564,933	D237E	probably benign	Het
Olfr8	T	A	10: 78,955,724	V173E	probably damaging	Het
Pgr	T	C	9: 8,958,410	V806A	possibly damaging	Het
Rad54b	T	C	4: 11,612,440		probably null	Het
Sdad1	A	T	5: 92,291,952	C405S	probably damaging	Het
Smg1	T	C	7: 118,145,606	I3108V	probably benign	Het
Spink5	A	T	18: 43,992,880	I409F	probably benign	Het
Syt13	C	A	2: 92,953,554	L390M	probably damaging	Het
Taf5	T	A	19: 47,075,773	V385E	probably damaging	Het
Tdrd9	T	A	12: 112,040,429	V909E	probably damaging	Het
Tex9	G	A	9: 72,480,658		probably benign	Het
Timm10b	G	T	7: 105,678,330	E61*	probably null	Het
Tmprss11g	A	T	5: 86,498,493	F72I	probably benign	Het
Trank1	T	C	9: 111,390,812	C2206R	probably benign	Het
Unc45b	GC	G	11: 82,925,988		probably null	Het
Unc93b1	T	C	19: 3,941,910	S215P	possibly damaging	Het
Usp48	C	T	4: 137,621,159		probably benign	Het
Vmn1r81	A	G	7: 12,259,955	V242A	possibly damaging	Het
Zgrf1	T	A	3: 127,596,024		probably null	Het

Other mutations in Adgrb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01525:Adgrb1	APN	15	74586835	missense	probably damaging	1.00
IGL01748:Adgrb1	APN	15	74548357	splice site	probably benign
IGL01874:Adgrb1	APN	15	74541574	missense	possibly damaging	0.95
IGL02040:Adgrb1	APN	15	74541575	missense	possibly damaging	0.91
IGL02138:Adgrb1	APN	15	74529782	missense	probably damaging	1.00
IGL02149:Adgrb1	APN	15	74540477	missense	probably damaging	1.00
IGL02320:Adgrb1	APN	15	74574112	missense	probably damaging	1.00
IGL02556:Adgrb1	APN	15	74586805	missense	probably damaging	0.99
IGL02637:Adgrb1	APN	15	74588294	splice site	probably benign
IGL02678:Adgrb1	APN	15	74538328	missense	probably damaging	0.99
IGL02792:Adgrb1	APN	15	74547622	missense	probably damaging	0.98
Bunting	UTSW	15	74543701	missense	probably null	0.94
BB005:Adgrb1	UTSW	15	74538321	missense	probably damaging	1.00
BB015:Adgrb1	UTSW	15	74538321	missense	probably damaging	1.00
PIT4520001:Adgrb1	UTSW	15	74541659	missense	probably damaging	0.99
R0193:Adgrb1	UTSW	15	74572156	missense	probably damaging	1.00
R0208:Adgrb1	UTSW	15	74586807	missense	probably benign
R0267:Adgrb1	UTSW	15	74529389	missense	probably damaging	1.00
R0336:Adgrb1	UTSW	15	74587149	missense	probably benign	0.06
R0345:Adgrb1	UTSW	15	74543349	missense	probably damaging	0.97
R0533:Adgrb1	UTSW	15	74541559	missense	probably damaging	1.00
R0635:Adgrb1	UTSW	15	74540892	missense	possibly damaging	0.88
R0729:Adgrb1	UTSW	15	74548549	missense	probably damaging	1.00
R0792:Adgrb1	UTSW	15	74580617	missense	probably damaging	1.00
R1122:Adgrb1	UTSW	15	74547685	missense	probably damaging	0.99
R1295:Adgrb1	UTSW	15	74550039	missense	probably damaging	1.00
R1522:Adgrb1	UTSW	15	74580617	missense	probably damaging	1.00
R1696:Adgrb1	UTSW	15	74588107	missense	probably damaging	1.00
R1707:Adgrb1	UTSW	15	74529343	missense	probably damaging	0.99
R1750:Adgrb1	UTSW	15	74541827	missense	probably benign	0.23
R1804:Adgrb1	UTSW	15	74529540	missense	probably damaging	1.00
R1829:Adgrb1	UTSW	15	74580586	nonsense	probably null
R1895:Adgrb1	UTSW	15	74540465	missense	probably damaging	1.00
R1970:Adgrb1	UTSW	15	74539877	splice site	probably benign
R2114:Adgrb1	UTSW	15	74540562	critical splice donor site	probably null
R2133:Adgrb1	UTSW	15	74529908	missense	probably damaging	1.00
R2210:Adgrb1	UTSW	15	74547704	missense	probably damaging	1.00
R3701:Adgrb1	UTSW	15	74545015	missense	probably damaging	0.99
R3770:Adgrb1	UTSW	15	74588308	missense	probably damaging	1.00
R3980:Adgrb1	UTSW	15	74582943	missense	probably damaging	1.00
R4355:Adgrb1	UTSW	15	74543662	missense	probably damaging	1.00
R4412:Adgrb1	UTSW	15	74577453	unclassified	probably benign
R4634:Adgrb1	UTSW	15	74584429	utr 3 prime	probably benign
R4683:Adgrb1	UTSW	15	74588114	missense	probably damaging	1.00
R4742:Adgrb1	UTSW	15	74529479	nonsense	probably null
R4760:Adgrb1	UTSW	15	74571463	missense	probably damaging	1.00
R4794:Adgrb1	UTSW	15	74588129	missense	probably damaging	1.00
R4880:Adgrb1	UTSW	15	74587022	missense	possibly damaging	0.85
R4885:Adgrb1	UTSW	15	74572162	missense	probably benign	0.04
R5092:Adgrb1	UTSW	15	74529815	missense	probably benign	0.39
R5198:Adgrb1	UTSW	15	74543701	missense	probably null	0.94
R5225:Adgrb1	UTSW	15	74577499	unclassified	probably benign
R5421:Adgrb1	UTSW	15	74550027	missense	probably damaging	1.00
R5764:Adgrb1	UTSW	15	74541574	missense	possibly damaging	0.95
R5914:Adgrb1	UTSW	15	74538370	missense	possibly damaging	0.54
R6035:Adgrb1	UTSW	15	74540443	missense	possibly damaging	0.50
R6035:Adgrb1	UTSW	15	74540443	missense	possibly damaging	0.50
R6066:Adgrb1	UTSW	15	74540459	missense	probably damaging	0.99
R6423:Adgrb1	UTSW	15	74588143	critical splice donor site	probably null
R6811:Adgrb1	UTSW	15	74529361	missense	probably damaging	1.00
R6945:Adgrb1	UTSW	15	74550024	missense	probably damaging	0.99
R7012:Adgrb1	UTSW	15	74529901	missense	probably damaging	0.97
R7015:Adgrb1	UTSW	15	74574110	missense	probably damaging	1.00
R7061:Adgrb1	UTSW	15	74569881	missense	probably benign	0.00
R7209:Adgrb1	UTSW	15	74569948	missense	possibly damaging	0.85
R7213:Adgrb1	UTSW	15	74569884	missense	probably benign
R7283:Adgrb1	UTSW	15	74580663	missense	possibly damaging	0.94
R7329:Adgrb1	UTSW	15	74539245	missense	probably damaging	0.99
R7616:Adgrb1	UTSW	15	74548569	missense	probably damaging	0.98
R7695:Adgrb1	UTSW	15	74543638	missense	possibly damaging	0.95
R7928:Adgrb1	UTSW	15	74538321	missense	probably damaging	1.00
R8152:Adgrb1	UTSW	15	74541611	missense	probably benign	0.00
R8152:Adgrb1	UTSW	15	74545000	missense	probably damaging	0.98
R8485:Adgrb1	UTSW	15	74548304	missense	probably damaging	1.00
R8528:Adgrb1	UTSW	15	74575851	missense	possibly damaging	0.51
R8534:Adgrb1	UTSW	15	74543508	missense	probably damaging	0.97
R8865:Adgrb1	UTSW	15	74543658	missense	possibly damaging	0.75
R9044:Adgrb1	UTSW	15	74569899	missense	possibly damaging	0.95
R9098:Adgrb1	UTSW	15	74543340	missense	probably damaging	1.00
R9157:Adgrb1	UTSW	15	74539775	missense	probably damaging	0.98
R9166:Adgrb1	UTSW	15	74548626	missense	probably benign	0.00
R9313:Adgrb1	UTSW	15	74539775	missense	probably damaging	0.98
R9445:Adgrb1	UTSW	15	74563958	critical splice acceptor site	probably benign
Z1177:Adgrb1	UTSW	15	74541676	missense	probably damaging	1.00
Z1177:Adgrb1	UTSW	15	74547683	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTGTCAGGGAACATGCTCTG -3'
(R):5'- GTCTGGTACAAACTAGATGAGATGC -3'

Sequencing Primer
(F):5'- TCTGCATGGGGCTGTCC -3'
(R):5'- ACTAGATGAGATGCATTATAGCCG -3'

Posted On

2020-07-13