Incidental Mutation 'R8198:Adgrb1'
ID 635561
Institutional Source Beutler Lab
Gene Symbol Adgrb1
Ensembl Gene ENSMUSG00000034730
Gene Name adhesion G protein-coupled receptor B1
Synonyms B830018M07Rik, Bai1
MMRRC Submission 067621-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8198 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 74388045-74461314 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 74411094 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 330 (T330K)
Ref Sequence ENSEMBL: ENSMUSP00000046097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042035] [ENSMUST00000186360] [ENSMUST00000187485]
AlphaFold Q3UHD1
Predicted Effect probably damaging
Transcript: ENSMUST00000042035
AA Change: T330K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046097
Gene: ENSMUSG00000034730
AA Change: T330K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 4.69e-10 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 3.5e-9 SMART
TSP1 412 462 3.16e-16 SMART
TSP1 470 520 7.15e-15 SMART
TSP1 525 575 3.11e-15 SMART
HormR 577 643 2.55e-20 SMART
Pfam:GAIN 656 859 1e-46 PFAM
GPS 880 938 1.46e-18 SMART
Pfam:7tm_2 944 1180 3.3e-66 PFAM
SCOP:d1jvr__ 1396 1432 5e-4 SMART
low complexity region 1441 1455 N/A INTRINSIC
low complexity region 1545 1556 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186360
AA Change: T330K

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140362
Gene: ENSMUSG00000034730
AA Change: T330K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 1.7e-11 SMART
TSP1 412 462 1.5e-18 SMART
TSP1 470 520 3.4e-17 SMART
TSP1 525 575 1.5e-17 SMART
HormR 577 643 1.6e-22 SMART
Pfam:DUF3497 653 874 1.2e-44 PFAM
GPS 880 938 8.9e-21 SMART
Pfam:7tm_2 944 1106 9.6e-43 PFAM
low complexity region 1113 1143 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187485
AA Change: T330K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140959
Gene: ENSMUSG00000034730
AA Change: T330K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189200
Meta Mutation Damage Score 0.0860 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik T C 14: 41,825,017 (GRCm39) *168R probably null Het
Ankrd27 T C 7: 35,307,880 (GRCm39) V373A probably benign Het
Aoah C T 13: 21,101,290 (GRCm39) P270L probably damaging Het
AU041133 C G 10: 81,987,249 (GRCm39) P301A probably damaging Het
Aven C T 2: 112,390,120 (GRCm39) R8W probably benign Het
Cd2bp2 A G 7: 126,793,576 (GRCm39) S204P possibly damaging Het
Clca4b C A 3: 144,638,167 (GRCm39) G32C probably damaging Het
Clcn2 A G 16: 20,525,946 (GRCm39) V808A probably damaging Het
Clec4d T C 6: 123,244,965 (GRCm39) C82R probably damaging Het
Dennd1c T C 17: 57,373,460 (GRCm39) D671G possibly damaging Het
Eml5 G A 12: 98,825,145 (GRCm39) R691* probably null Het
Fcnb C T 2: 27,968,330 (GRCm39) S209N possibly damaging Het
Gm4922 T C 10: 18,659,340 (GRCm39) T461A probably benign Het
Gm9964 A G 11: 79,187,405 (GRCm39) V14A unknown Het
Gnb3 T C 6: 124,814,000 (GRCm39) Y196C probably benign Het
H4c2 C G 13: 23,941,283 (GRCm39) Q94E possibly damaging Het
Hps1 C T 19: 42,755,659 (GRCm39) R189Q probably benign Het
Iars2 G A 1: 185,029,703 (GRCm39) T638I probably benign Het
Itpripl2 A G 7: 118,089,819 (GRCm39) S247P probably damaging Het
Leng8 C A 7: 4,147,170 (GRCm39) R523S possibly damaging Het
Lhfpl3 T A 5: 23,478,333 (GRCm39) V72D probably benign Het
Lmntd2 A T 7: 140,791,134 (GRCm39) M426K possibly damaging Het
Lsg1 A T 16: 30,383,594 (GRCm39) V542E probably benign Het
Mphosph6 C T 8: 118,519,449 (GRCm39) V108I probably benign Het
Mta2 A G 19: 8,925,145 (GRCm39) T338A probably benign Het
Ncoa7 T C 10: 30,580,664 (GRCm39) N98S probably benign Het
Or52h7 T A 7: 104,214,140 (GRCm39) D237E probably benign Het
Or7a36 C A 10: 78,820,443 (GRCm39) T273K probably benign Het
Or7a42 T A 10: 78,791,558 (GRCm39) V173E probably damaging Het
Pgr T C 9: 8,958,411 (GRCm39) V806A possibly damaging Het
Rad54b T C 4: 11,612,440 (GRCm39) probably null Het
Sdad1 A T 5: 92,439,811 (GRCm39) C405S probably damaging Het
Semp2l2a T A 8: 13,887,056 (GRCm39) Y345F probably benign Het
Shoc1 T C 4: 59,065,174 (GRCm39) I814V probably benign Het
Smg1 T C 7: 117,744,829 (GRCm39) I3108V probably benign Het
Spink5 A T 18: 44,125,947 (GRCm39) I409F probably benign Het
Syt13 C A 2: 92,783,899 (GRCm39) L390M probably damaging Het
Taf5 T A 19: 47,064,212 (GRCm39) V385E probably damaging Het
Tdrd9 T A 12: 112,006,863 (GRCm39) V909E probably damaging Het
Tex9 G A 9: 72,387,940 (GRCm39) probably benign Het
Timm10b G T 7: 105,327,537 (GRCm39) E61* probably null Het
Tmprss11g A T 5: 86,646,352 (GRCm39) F72I probably benign Het
Trank1 T C 9: 111,219,880 (GRCm39) C2206R probably benign Het
Uba52rt C A 4: 3,973,346 (GRCm39) R72L probably benign Het
Unc45b GC G 11: 82,816,814 (GRCm39) probably null Het
Unc93b1 T C 19: 3,991,910 (GRCm39) S215P possibly damaging Het
Usp48 C T 4: 137,348,470 (GRCm39) probably benign Het
Vmn1r81 A G 7: 11,993,882 (GRCm39) V242A possibly damaging Het
Zgrf1 T A 3: 127,389,673 (GRCm39) probably null Het
Other mutations in Adgrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Adgrb1 APN 15 74,458,684 (GRCm39) missense probably damaging 1.00
IGL01748:Adgrb1 APN 15 74,420,206 (GRCm39) splice site probably benign
IGL01874:Adgrb1 APN 15 74,413,423 (GRCm39) missense possibly damaging 0.95
IGL02040:Adgrb1 APN 15 74,413,424 (GRCm39) missense possibly damaging 0.91
IGL02138:Adgrb1 APN 15 74,401,631 (GRCm39) missense probably damaging 1.00
IGL02149:Adgrb1 APN 15 74,412,326 (GRCm39) missense probably damaging 1.00
IGL02320:Adgrb1 APN 15 74,445,961 (GRCm39) missense probably damaging 1.00
IGL02556:Adgrb1 APN 15 74,458,654 (GRCm39) missense probably damaging 0.99
IGL02637:Adgrb1 APN 15 74,460,143 (GRCm39) splice site probably benign
IGL02678:Adgrb1 APN 15 74,410,177 (GRCm39) missense probably damaging 0.99
IGL02792:Adgrb1 APN 15 74,419,471 (GRCm39) missense probably damaging 0.98
Bunting UTSW 15 74,415,550 (GRCm39) missense probably null 0.94
BB005:Adgrb1 UTSW 15 74,410,170 (GRCm39) missense probably damaging 1.00
BB015:Adgrb1 UTSW 15 74,410,170 (GRCm39) missense probably damaging 1.00
PIT4520001:Adgrb1 UTSW 15 74,413,508 (GRCm39) missense probably damaging 0.99
R0193:Adgrb1 UTSW 15 74,444,005 (GRCm39) missense probably damaging 1.00
R0208:Adgrb1 UTSW 15 74,458,656 (GRCm39) missense probably benign
R0267:Adgrb1 UTSW 15 74,401,238 (GRCm39) missense probably damaging 1.00
R0336:Adgrb1 UTSW 15 74,458,998 (GRCm39) missense probably benign 0.06
R0345:Adgrb1 UTSW 15 74,415,198 (GRCm39) missense probably damaging 0.97
R0533:Adgrb1 UTSW 15 74,413,408 (GRCm39) missense probably damaging 1.00
R0635:Adgrb1 UTSW 15 74,412,741 (GRCm39) missense possibly damaging 0.88
R0729:Adgrb1 UTSW 15 74,420,398 (GRCm39) missense probably damaging 1.00
R0792:Adgrb1 UTSW 15 74,452,466 (GRCm39) missense probably damaging 1.00
R1122:Adgrb1 UTSW 15 74,419,534 (GRCm39) missense probably damaging 0.99
R1295:Adgrb1 UTSW 15 74,421,888 (GRCm39) missense probably damaging 1.00
R1522:Adgrb1 UTSW 15 74,452,466 (GRCm39) missense probably damaging 1.00
R1696:Adgrb1 UTSW 15 74,459,956 (GRCm39) missense probably damaging 1.00
R1707:Adgrb1 UTSW 15 74,401,192 (GRCm39) missense probably damaging 0.99
R1750:Adgrb1 UTSW 15 74,413,676 (GRCm39) missense probably benign 0.23
R1804:Adgrb1 UTSW 15 74,401,389 (GRCm39) missense probably damaging 1.00
R1829:Adgrb1 UTSW 15 74,452,435 (GRCm39) nonsense probably null
R1895:Adgrb1 UTSW 15 74,412,314 (GRCm39) missense probably damaging 1.00
R1970:Adgrb1 UTSW 15 74,411,726 (GRCm39) splice site probably benign
R2114:Adgrb1 UTSW 15 74,412,411 (GRCm39) critical splice donor site probably null
R2133:Adgrb1 UTSW 15 74,401,757 (GRCm39) missense probably damaging 1.00
R2210:Adgrb1 UTSW 15 74,419,553 (GRCm39) missense probably damaging 1.00
R3701:Adgrb1 UTSW 15 74,416,864 (GRCm39) missense probably damaging 0.99
R3770:Adgrb1 UTSW 15 74,460,157 (GRCm39) missense probably damaging 1.00
R3980:Adgrb1 UTSW 15 74,454,792 (GRCm39) missense probably damaging 1.00
R4355:Adgrb1 UTSW 15 74,415,511 (GRCm39) missense probably damaging 1.00
R4412:Adgrb1 UTSW 15 74,449,302 (GRCm39) unclassified probably benign
R4634:Adgrb1 UTSW 15 74,456,278 (GRCm39) utr 3 prime probably benign
R4683:Adgrb1 UTSW 15 74,459,963 (GRCm39) missense probably damaging 1.00
R4742:Adgrb1 UTSW 15 74,401,328 (GRCm39) nonsense probably null
R4760:Adgrb1 UTSW 15 74,443,312 (GRCm39) missense probably damaging 1.00
R4794:Adgrb1 UTSW 15 74,459,978 (GRCm39) missense probably damaging 1.00
R4880:Adgrb1 UTSW 15 74,458,871 (GRCm39) missense possibly damaging 0.85
R4885:Adgrb1 UTSW 15 74,444,011 (GRCm39) missense probably benign 0.04
R5092:Adgrb1 UTSW 15 74,401,664 (GRCm39) missense probably benign 0.39
R5198:Adgrb1 UTSW 15 74,415,550 (GRCm39) missense probably null 0.94
R5225:Adgrb1 UTSW 15 74,449,348 (GRCm39) unclassified probably benign
R5421:Adgrb1 UTSW 15 74,421,876 (GRCm39) missense probably damaging 1.00
R5764:Adgrb1 UTSW 15 74,413,423 (GRCm39) missense possibly damaging 0.95
R5914:Adgrb1 UTSW 15 74,410,219 (GRCm39) missense possibly damaging 0.54
R6035:Adgrb1 UTSW 15 74,412,292 (GRCm39) missense possibly damaging 0.50
R6035:Adgrb1 UTSW 15 74,412,292 (GRCm39) missense possibly damaging 0.50
R6066:Adgrb1 UTSW 15 74,412,308 (GRCm39) missense probably damaging 0.99
R6423:Adgrb1 UTSW 15 74,459,992 (GRCm39) critical splice donor site probably null
R6811:Adgrb1 UTSW 15 74,401,210 (GRCm39) missense probably damaging 1.00
R6945:Adgrb1 UTSW 15 74,421,873 (GRCm39) missense probably damaging 0.99
R7012:Adgrb1 UTSW 15 74,401,750 (GRCm39) missense probably damaging 0.97
R7015:Adgrb1 UTSW 15 74,445,959 (GRCm39) missense probably damaging 1.00
R7061:Adgrb1 UTSW 15 74,441,730 (GRCm39) missense probably benign 0.00
R7209:Adgrb1 UTSW 15 74,441,797 (GRCm39) missense possibly damaging 0.85
R7213:Adgrb1 UTSW 15 74,441,733 (GRCm39) missense probably benign
R7283:Adgrb1 UTSW 15 74,452,512 (GRCm39) missense possibly damaging 0.94
R7329:Adgrb1 UTSW 15 74,411,094 (GRCm39) missense probably damaging 0.99
R7616:Adgrb1 UTSW 15 74,420,418 (GRCm39) missense probably damaging 0.98
R7695:Adgrb1 UTSW 15 74,415,487 (GRCm39) missense possibly damaging 0.95
R7928:Adgrb1 UTSW 15 74,410,170 (GRCm39) missense probably damaging 1.00
R8152:Adgrb1 UTSW 15 74,416,849 (GRCm39) missense probably damaging 0.98
R8152:Adgrb1 UTSW 15 74,413,460 (GRCm39) missense probably benign 0.00
R8485:Adgrb1 UTSW 15 74,420,153 (GRCm39) missense probably damaging 1.00
R8528:Adgrb1 UTSW 15 74,447,700 (GRCm39) missense possibly damaging 0.51
R8534:Adgrb1 UTSW 15 74,415,357 (GRCm39) missense probably damaging 0.97
R8865:Adgrb1 UTSW 15 74,415,507 (GRCm39) missense possibly damaging 0.75
R9044:Adgrb1 UTSW 15 74,441,748 (GRCm39) missense possibly damaging 0.95
R9098:Adgrb1 UTSW 15 74,415,189 (GRCm39) missense probably damaging 1.00
R9157:Adgrb1 UTSW 15 74,411,624 (GRCm39) missense probably damaging 0.98
R9166:Adgrb1 UTSW 15 74,420,475 (GRCm39) missense probably benign 0.00
R9313:Adgrb1 UTSW 15 74,411,624 (GRCm39) missense probably damaging 0.98
R9445:Adgrb1 UTSW 15 74,435,807 (GRCm39) critical splice acceptor site probably benign
Z1177:Adgrb1 UTSW 15 74,419,532 (GRCm39) missense probably damaging 0.99
Z1177:Adgrb1 UTSW 15 74,413,525 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCAGGGAACATGCTCTG -3'
(R):5'- GTCTGGTACAAACTAGATGAGATGC -3'

Sequencing Primer
(F):5'- TCTGCATGGGGCTGTCC -3'
(R):5'- ACTAGATGAGATGCATTATAGCCG -3'
Posted On 2020-07-13