Incidental Mutation 'R8198:Adgrb1'
ID635561
Institutional Source Beutler Lab
Gene Symbol Adgrb1
Ensembl Gene ENSMUSG00000034730
Gene Nameadhesion G protein-coupled receptor B1
SynonymsBai1, B830018M07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8198 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location74516195-74589465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 74539245 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 330 (T330K)
Ref Sequence ENSEMBL: ENSMUSP00000046097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042035] [ENSMUST00000186360] [ENSMUST00000187485]
Predicted Effect probably damaging
Transcript: ENSMUST00000042035
AA Change: T330K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046097
Gene: ENSMUSG00000034730
AA Change: T330K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 4.69e-10 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 3.5e-9 SMART
TSP1 412 462 3.16e-16 SMART
TSP1 470 520 7.15e-15 SMART
TSP1 525 575 3.11e-15 SMART
HormR 577 643 2.55e-20 SMART
Pfam:GAIN 656 859 1e-46 PFAM
GPS 880 938 1.46e-18 SMART
Pfam:7tm_2 944 1180 3.3e-66 PFAM
SCOP:d1jvr__ 1396 1432 5e-4 SMART
low complexity region 1441 1455 N/A INTRINSIC
low complexity region 1545 1556 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186360
AA Change: T330K

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140362
Gene: ENSMUSG00000034730
AA Change: T330K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 1.7e-11 SMART
TSP1 412 462 1.5e-18 SMART
TSP1 470 520 3.4e-17 SMART
TSP1 525 575 1.5e-17 SMART
HormR 577 643 1.6e-22 SMART
Pfam:DUF3497 653 874 1.2e-44 PFAM
GPS 880 938 8.9e-21 SMART
Pfam:7tm_2 944 1106 9.6e-43 PFAM
low complexity region 1113 1143 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187485
AA Change: T330K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140959
Gene: ENSMUSG00000034730
AA Change: T330K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189200
Meta Mutation Damage Score 0.0860 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik T C 14: 42,003,060 *168R probably null Het
AF366264 T A 8: 13,837,056 Y345F probably benign Het
AI481877 T C 4: 59,065,174 I814V probably benign Het
Ankrd27 T C 7: 35,608,455 V373A probably benign Het
Aoah C T 13: 20,917,120 P270L probably damaging Het
AU041133 C G 10: 82,151,415 P301A probably damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
Cd2bp2 A G 7: 127,194,404 S204P possibly damaging Het
Clca4b C A 3: 144,932,406 G32C probably damaging Het
Clcn2 A G 16: 20,707,196 V808A probably damaging Het
Clec4d T C 6: 123,268,006 C82R probably damaging Het
Dennd1c T C 17: 57,066,460 D671G possibly damaging Het
Eml5 G A 12: 98,858,886 R691* probably null Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gm11808 C A 4: 3,973,346 R72L probably benign Het
Gm4922 T C 10: 18,783,592 T461A probably benign Het
Gm9964 A G 11: 79,296,579 V14A unknown Het
Gnb3 T C 6: 124,837,037 Y196C probably benign Het
Hist1h4b C G 13: 23,757,300 Q94E possibly damaging Het
Hps1 C T 19: 42,767,220 R189Q probably benign Het
Iars2 G A 1: 185,297,506 T638I probably benign Het
Itpripl2 A G 7: 118,490,596 S247P probably damaging Het
Leng8 C A 7: 4,144,171 R523S possibly damaging Het
Lhfpl3 T A 5: 23,273,335 V72D probably benign Het
Lmntd2 A T 7: 141,211,221 M426K possibly damaging Het
Lsg1 A T 16: 30,564,776 V542E probably benign Het
Mphosph6 C T 8: 117,792,710 V108I probably benign Het
Mta2 A G 19: 8,947,781 T338A probably benign Het
Ncoa7 T C 10: 30,704,668 N98S probably benign Het
Olfr1352 C A 10: 78,984,609 T273K probably benign Het
Olfr652 T A 7: 104,564,933 D237E probably benign Het
Olfr8 T A 10: 78,955,724 V173E probably damaging Het
Pgr T C 9: 8,958,410 V806A possibly damaging Het
Rad54b T C 4: 11,612,440 probably null Het
Sdad1 A T 5: 92,291,952 C405S probably damaging Het
Smg1 T C 7: 118,145,606 I3108V probably benign Het
Spink5 A T 18: 43,992,880 I409F probably benign Het
Syt13 C A 2: 92,953,554 L390M probably damaging Het
Taf5 T A 19: 47,075,773 V385E probably damaging Het
Tdrd9 T A 12: 112,040,429 V909E probably damaging Het
Tex9 G A 9: 72,480,658 probably benign Het
Timm10b G T 7: 105,678,330 E61* probably null Het
Tmprss11g A T 5: 86,498,493 F72I probably benign Het
Trank1 T C 9: 111,390,812 C2206R probably benign Het
Unc45b GC G 11: 82,925,988 probably null Het
Unc93b1 T C 19: 3,941,910 S215P possibly damaging Het
Usp48 C T 4: 137,621,159 probably benign Het
Vmn1r81 A G 7: 12,259,955 V242A possibly damaging Het
Zgrf1 T A 3: 127,596,024 probably null Het
Other mutations in Adgrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Adgrb1 APN 15 74586835 missense probably damaging 1.00
IGL01748:Adgrb1 APN 15 74548357 splice site probably benign
IGL01874:Adgrb1 APN 15 74541574 missense possibly damaging 0.95
IGL02040:Adgrb1 APN 15 74541575 missense possibly damaging 0.91
IGL02138:Adgrb1 APN 15 74529782 missense probably damaging 1.00
IGL02149:Adgrb1 APN 15 74540477 missense probably damaging 1.00
IGL02320:Adgrb1 APN 15 74574112 missense probably damaging 1.00
IGL02556:Adgrb1 APN 15 74586805 missense probably damaging 0.99
IGL02637:Adgrb1 APN 15 74588294 splice site probably benign
IGL02678:Adgrb1 APN 15 74538328 missense probably damaging 0.99
IGL02792:Adgrb1 APN 15 74547622 missense probably damaging 0.98
Bunting UTSW 15 74543701 missense probably null 0.94
BB005:Adgrb1 UTSW 15 74538321 missense probably damaging 1.00
BB015:Adgrb1 UTSW 15 74538321 missense probably damaging 1.00
PIT4520001:Adgrb1 UTSW 15 74541659 missense probably damaging 0.99
R0193:Adgrb1 UTSW 15 74572156 missense probably damaging 1.00
R0208:Adgrb1 UTSW 15 74586807 missense probably benign
R0267:Adgrb1 UTSW 15 74529389 missense probably damaging 1.00
R0336:Adgrb1 UTSW 15 74587149 missense probably benign 0.06
R0345:Adgrb1 UTSW 15 74543349 missense probably damaging 0.97
R0533:Adgrb1 UTSW 15 74541559 missense probably damaging 1.00
R0635:Adgrb1 UTSW 15 74540892 missense possibly damaging 0.88
R0729:Adgrb1 UTSW 15 74548549 missense probably damaging 1.00
R0792:Adgrb1 UTSW 15 74580617 missense probably damaging 1.00
R1122:Adgrb1 UTSW 15 74547685 missense probably damaging 0.99
R1295:Adgrb1 UTSW 15 74550039 missense probably damaging 1.00
R1522:Adgrb1 UTSW 15 74580617 missense probably damaging 1.00
R1696:Adgrb1 UTSW 15 74588107 missense probably damaging 1.00
R1707:Adgrb1 UTSW 15 74529343 missense probably damaging 0.99
R1750:Adgrb1 UTSW 15 74541827 missense probably benign 0.23
R1804:Adgrb1 UTSW 15 74529540 missense probably damaging 1.00
R1829:Adgrb1 UTSW 15 74580586 nonsense probably null
R1895:Adgrb1 UTSW 15 74540465 missense probably damaging 1.00
R1970:Adgrb1 UTSW 15 74539877 splice site probably benign
R2114:Adgrb1 UTSW 15 74540562 critical splice donor site probably null
R2133:Adgrb1 UTSW 15 74529908 missense probably damaging 1.00
R2210:Adgrb1 UTSW 15 74547704 missense probably damaging 1.00
R3701:Adgrb1 UTSW 15 74545015 missense probably damaging 0.99
R3770:Adgrb1 UTSW 15 74588308 missense probably damaging 1.00
R3980:Adgrb1 UTSW 15 74582943 missense probably damaging 1.00
R4355:Adgrb1 UTSW 15 74543662 missense probably damaging 1.00
R4412:Adgrb1 UTSW 15 74577453 unclassified probably benign
R4634:Adgrb1 UTSW 15 74584429 utr 3 prime probably benign
R4683:Adgrb1 UTSW 15 74588114 missense probably damaging 1.00
R4742:Adgrb1 UTSW 15 74529479 nonsense probably null
R4760:Adgrb1 UTSW 15 74571463 missense probably damaging 1.00
R4794:Adgrb1 UTSW 15 74588129 missense probably damaging 1.00
R4880:Adgrb1 UTSW 15 74587022 missense possibly damaging 0.85
R4885:Adgrb1 UTSW 15 74572162 missense probably benign 0.04
R5092:Adgrb1 UTSW 15 74529815 missense probably benign 0.39
R5198:Adgrb1 UTSW 15 74543701 missense probably null 0.94
R5225:Adgrb1 UTSW 15 74577499 unclassified probably benign
R5421:Adgrb1 UTSW 15 74550027 missense probably damaging 1.00
R5764:Adgrb1 UTSW 15 74541574 missense possibly damaging 0.95
R5914:Adgrb1 UTSW 15 74538370 missense possibly damaging 0.54
R6035:Adgrb1 UTSW 15 74540443 missense possibly damaging 0.50
R6035:Adgrb1 UTSW 15 74540443 missense possibly damaging 0.50
R6066:Adgrb1 UTSW 15 74540459 missense probably damaging 0.99
R6423:Adgrb1 UTSW 15 74588143 critical splice donor site probably null
R6811:Adgrb1 UTSW 15 74529361 missense probably damaging 1.00
R6945:Adgrb1 UTSW 15 74550024 missense probably damaging 0.99
R7012:Adgrb1 UTSW 15 74529901 missense probably damaging 0.97
R7015:Adgrb1 UTSW 15 74574110 missense probably damaging 1.00
R7061:Adgrb1 UTSW 15 74569881 missense probably benign 0.00
R7209:Adgrb1 UTSW 15 74569948 missense possibly damaging 0.85
R7213:Adgrb1 UTSW 15 74569884 missense probably benign
R7283:Adgrb1 UTSW 15 74580663 missense possibly damaging 0.94
R7329:Adgrb1 UTSW 15 74539245 missense probably damaging 0.99
R7616:Adgrb1 UTSW 15 74548569 missense probably damaging 0.98
R7695:Adgrb1 UTSW 15 74543638 missense possibly damaging 0.95
R7928:Adgrb1 UTSW 15 74538321 missense probably damaging 1.00
R8152:Adgrb1 UTSW 15 74541611 missense probably benign 0.00
R8152:Adgrb1 UTSW 15 74545000 missense probably damaging 0.98
R8485:Adgrb1 UTSW 15 74548304 missense probably damaging 1.00
R8528:Adgrb1 UTSW 15 74575851 missense possibly damaging 0.51
R8534:Adgrb1 UTSW 15 74543508 missense probably damaging 0.97
R8865:Adgrb1 UTSW 15 74543658 missense possibly damaging 0.75
Z1177:Adgrb1 UTSW 15 74541676 missense probably damaging 1.00
Z1177:Adgrb1 UTSW 15 74547683 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGTCAGGGAACATGCTCTG -3'
(R):5'- GTCTGGTACAAACTAGATGAGATGC -3'

Sequencing Primer
(F):5'- TCTGCATGGGGCTGTCC -3'
(R):5'- ACTAGATGAGATGCATTATAGCCG -3'
Posted On2020-07-13