Incidental Mutation 'R8199:Skida1'
ID635570
Institutional Source Beutler Lab
Gene Symbol Skida1
Ensembl Gene ENSMUSG00000054074
Gene NameSKI/DACH domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R8199 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location18040676-18049051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 18048148 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 64 (L64F)
Ref Sequence ENSEMBL: ENSMUSP00000068520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066885] [ENSMUST00000091420] [ENSMUST00000142856] [ENSMUST00000152908]
Predicted Effect probably damaging
Transcript: ENSMUST00000066885
AA Change: L64F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068520
Gene: ENSMUSG00000054074
AA Change: L64F

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 98 4.1e-19 PFAM
low complexity region 116 130 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 262 279 N/A INTRINSIC
low complexity region 282 297 N/A INTRINSIC
coiled coil region 315 337 N/A INTRINSIC
Pfam:DUF4584 383 820 9.7e-162 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091420
AA Change: L64F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088982
Gene: ENSMUSG00000054074
AA Change: L64F

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 97 7.7e-17 PFAM
low complexity region 116 130 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
SCOP:d1gkub1 224 254 3e-3 SMART
SCOP:d1gkub1 296 321 6e-3 SMART
low complexity region 349 366 N/A INTRINSIC
low complexity region 369 384 N/A INTRINSIC
coiled coil region 402 424 N/A INTRINSIC
Pfam:DUF4584 471 907 7.7e-179 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142856
AA Change: L64F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122112
Gene: ENSMUSG00000054074
AA Change: L64F

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 98 4.4e-20 PFAM
low complexity region 116 130 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152908
AA Change: L64F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114785
Gene: ENSMUSG00000054074
AA Change: L64F

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 65 2.8e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,625,880 Y336H probably damaging Het
4930563I02Rik A G 14: 60,095,939 I42M noncoding transcript Het
9330182L06Rik C T 5: 9,420,657 T260M probably damaging Het
Acad9 T C 3: 36,085,423 S391P probably damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
Cacna1c T C 6: 118,674,584 T972A probably benign Het
Col25a1 G A 3: 130,551,979 G406E probably damaging Het
Coro2b T G 9: 62,429,020 I267L probably benign Het
Cst12 A G 2: 148,789,539 N60S probably benign Het
Dnah8 A T 17: 30,871,419 I4632F probably benign Het
Eif3d C T 15: 77,960,092 C404Y possibly damaging Het
Fam43a A T 16: 30,600,768 K57* probably null Het
Fbrs T C 7: 127,487,784 probably null Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Fggy G A 4: 95,812,144 E351K probably benign Het
Gabra6 G A 11: 42,316,453 S268L probably damaging Het
Gatm A G 2: 122,602,513 Y223H probably damaging Het
Gli3 T A 13: 15,725,991 M1321K probably benign Het
Hira G A 16: 18,947,444 A669T probably benign Het
Hoxa5 T C 6: 52,204,260 S31G probably benign Het
Kdm2a T A 19: 4,389,026 Q25L unknown Het
Loxhd1 C A 18: 77,381,638 N1000K possibly damaging Het
Mpdu1 C T 11: 69,657,243 W235* probably null Het
Msantd2 G C 9: 37,489,493 G57A probably benign Het
Nat1 A G 8: 67,490,998 R9G probably damaging Het
Nbl1 G A 4: 139,083,569 P105S probably damaging Het
Olfr137 T C 17: 38,304,553 R303G probably benign Het
Olfr677 A C 7: 105,056,645 Q133P probably damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pdzrn3 T C 6: 101,151,957 S583G probably damaging Het
Prpf4 A G 4: 62,422,629 D427G probably damaging Het
Ptpn21 T A 12: 98,678,582 I1167F possibly damaging Het
Rasgrp1 T A 2: 117,293,812 H303L probably damaging Het
Ros1 T A 10: 52,101,717 K1499* probably null Het
St3gal5 T C 6: 72,142,191 Y123H probably benign Het
Syk T C 13: 52,624,732 S285P probably benign Het
Syt4 T C 18: 31,444,215 T29A probably benign Het
Trav7-3 A G 14: 53,443,642 D47G possibly damaging Het
Trpm7 A G 2: 126,849,998 F146L probably damaging Het
Utp20 A T 10: 88,798,475 D786E probably benign Het
Uts2 G A 4: 151,001,658 C117Y possibly damaging Het
Zfp553 T C 7: 127,236,296 L341P probably damaging Het
Zfp994 T A 17: 22,200,223 K582* probably null Het
Other mutations in Skida1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02315:Skida1 APN 2 18046005 unclassified probably benign
IGL03220:Skida1 APN 2 18048161 missense probably damaging 1.00
R0328:Skida1 UTSW 2 18047186 unclassified probably benign
R0732:Skida1 UTSW 2 18046157 unclassified probably benign
R1239:Skida1 UTSW 2 18047317 unclassified probably benign
R1346:Skida1 UTSW 2 18048279 missense possibly damaging 0.92
R1597:Skida1 UTSW 2 18046332 unclassified probably benign
R1867:Skida1 UTSW 2 18046344 unclassified probably benign
R3797:Skida1 UTSW 2 18045897 nonsense probably null
R4521:Skida1 UTSW 2 18045872 unclassified probably benign
R5270:Skida1 UTSW 2 18047649 missense probably benign 0.03
R5467:Skida1 UTSW 2 18046112 unclassified probably benign
R5890:Skida1 UTSW 2 18046003 unclassified probably benign
R7181:Skida1 UTSW 2 18046791 missense unknown
R7398:Skida1 UTSW 2 18046272 missense unknown
R8103:Skida1 UTSW 2 18047738 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGTTGGTGCTTGTCCTTCC -3'
(R):5'- CTGAAGTCAGGTTTCGAAGAGGTG -3'

Sequencing Primer
(F):5'- TTGTCCTTCCAAAAAGCCGGG -3'
(R):5'- CAGGTTTCGAAGAGGTGGATGG -3'
Posted On2020-07-13