Incidental Mutation 'R8199:Fcnb'
ID 635571
Institutional Source Beutler Lab
Gene Symbol Fcnb
Ensembl Gene ENSMUSG00000026835
Gene Name ficolin B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8199 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 28076378-28084885 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 28078318 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 209 (S209N)
Ref Sequence ENSEMBL: ENSMUSP00000028179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028179] [ENSMUST00000117486] [ENSMUST00000135472]
AlphaFold O70497
Predicted Effect possibly damaging
Transcript: ENSMUST00000028179
AA Change: S209N

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028179
Gene: ENSMUSG00000026835
AA Change: S209N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 39 99 1.1e-11 PFAM
FBG 101 314 1.78e-115 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117486
AA Change: S209N

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112625
Gene: ENSMUSG00000026835
AA Change: S209N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 39 99 6.7e-12 PFAM
FBG 101 250 1.33e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135472
SMART Domains Protein: ENSMUSP00000119098
Gene: ENSMUSG00000026835

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 38 81 5.3e-10 PFAM
internal_repeat_1 86 107 1.19e-5 PROSPERO
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. The collagen-like and the fibrinogen-like domains are also found separately in other proteins such as complement protein C1q, C-type lectins known as collectins, and tenascins. However, all these proteins recognize different targets, and are functionally distinct. Ficolin 1 encoded by FCN1 is predominantly expressed in the peripheral blood leukocytes, and has been postulated to function as a plasma protein with elastin-binding activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to Streptococcus pneumoniae infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,625,880 Y336H probably damaging Het
4930563I02Rik A G 14: 60,095,939 I42M noncoding transcript Het
9330182L06Rik C T 5: 9,420,657 T260M probably damaging Het
Acad9 T C 3: 36,085,423 S391P probably damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
Cacna1c T C 6: 118,674,584 T972A probably benign Het
Col25a1 G A 3: 130,551,979 G406E probably damaging Het
Coro2b T G 9: 62,429,020 I267L probably benign Het
Cst12 A G 2: 148,789,539 N60S probably benign Het
Dnah8 A T 17: 30,871,419 I4632F probably benign Het
Eif3d C T 15: 77,960,092 C404Y possibly damaging Het
Fam43a A T 16: 30,600,768 K57* probably null Het
Fbrs T C 7: 127,487,784 probably null Het
Fggy G A 4: 95,812,144 E351K probably benign Het
Gabra6 G A 11: 42,316,453 S268L probably damaging Het
Gatm A G 2: 122,602,513 Y223H probably damaging Het
Gli3 T A 13: 15,725,991 M1321K probably benign Het
Hira G A 16: 18,947,444 A669T probably benign Het
Hoxa5 T C 6: 52,204,260 S31G probably benign Het
Kdm2a T A 19: 4,389,026 Q25L unknown Het
Loxhd1 C A 18: 77,381,638 N1000K possibly damaging Het
Mpdu1 C T 11: 69,657,243 W235* probably null Het
Msantd2 G C 9: 37,489,493 G57A probably benign Het
Nat1 A G 8: 67,490,998 R9G probably damaging Het
Nbl1 G A 4: 139,083,569 P105S probably damaging Het
Olfr137 T C 17: 38,304,553 R303G probably benign Het
Olfr677 A C 7: 105,056,645 Q133P probably damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pdzrn3 T C 6: 101,151,957 S583G probably damaging Het
Prpf4 A G 4: 62,422,629 D427G probably damaging Het
Ptpn21 T A 12: 98,678,582 I1167F possibly damaging Het
Rasgrp1 T A 2: 117,293,812 H303L probably damaging Het
Ros1 T A 10: 52,101,717 K1499* probably null Het
Skida1 C A 2: 18,048,148 L64F probably damaging Het
St3gal5 T C 6: 72,142,191 Y123H probably benign Het
Syk T C 13: 52,624,732 S285P probably benign Het
Syt4 T C 18: 31,444,215 T29A probably benign Het
Trav7-3 A G 14: 53,443,642 D47G possibly damaging Het
Trpm7 A G 2: 126,849,998 F146L probably damaging Het
Utp20 A T 10: 88,798,475 D786E probably benign Het
Uts2 G A 4: 151,001,658 C117Y possibly damaging Het
Zfp553 T C 7: 127,236,296 L341P probably damaging Het
Zfp994 T A 17: 22,200,223 K582* probably null Het
Other mutations in Fcnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Fcnb APN 2 28076801 missense probably benign 0.04
IGL02130:Fcnb APN 2 28084789 critical splice donor site probably null
IGL02348:Fcnb APN 2 28084830 missense possibly damaging 0.88
IGL02504:Fcnb APN 2 28076594 missense probably damaging 1.00
IGL03118:Fcnb APN 2 28076618 missense probably benign 0.06
IGL03179:Fcnb APN 2 28076634 missense possibly damaging 0.93
R0217:Fcnb UTSW 2 28079677 missense probably benign 0.02
R0899:Fcnb UTSW 2 28076779 missense probably damaging 1.00
R3901:Fcnb UTSW 2 28079196 missense probably damaging 1.00
R5845:Fcnb UTSW 2 28079621 critical splice donor site probably null
R5911:Fcnb UTSW 2 28076689 missense probably damaging 1.00
R6065:Fcnb UTSW 2 28079910 missense probably damaging 1.00
R6188:Fcnb UTSW 2 28079190 missense possibly damaging 0.94
R6488:Fcnb UTSW 2 28078289 missense probably damaging 1.00
R8058:Fcnb UTSW 2 28079695 missense probably damaging 1.00
R8194:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8195:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8196:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8198:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8678:Fcnb UTSW 2 28078349 missense possibly damaging 0.61
R9224:Fcnb UTSW 2 28079148 missense probably damaging 1.00
R9261:Fcnb UTSW 2 28079624 missense probably damaging 0.99
X0024:Fcnb UTSW 2 28076691 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCGCTGATGTCAACCCTAGG -3'
(R):5'- CAAAGATGTTGGTACCTACCCC -3'

Sequencing Primer
(F):5'- TGATGTCAACCCTAGGCTCAAGG -3'
(R):5'- CCCGGTGAATTCCAAGTTCAG -3'
Posted On 2020-07-13