Incidental Mutation 'R8199:Olfr137'
ID635610
Institutional Source Beutler Lab
Gene Symbol Olfr137
Ensembl Gene ENSMUSG00000054940
Gene Nameolfactory receptor 137
SynonymsMOR256-18, GA_x6K02T2PSCP-2749525-2748587
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R8199 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location38303527-38307570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38304553 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 303 (R303G)
Ref Sequence ENSEMBL: ENSMUSP00000051537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057394]
Predicted Effect probably benign
Transcript: ENSMUST00000057394
AA Change: R303G

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000051537
Gene: ENSMUSG00000054940
AA Change: R303G

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 4e-49 PFAM
Pfam:7tm_1 42 291 4.5e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,625,880 Y336H probably damaging Het
4930563I02Rik A G 14: 60,095,939 I42M noncoding transcript Het
9330182L06Rik C T 5: 9,420,657 T260M probably damaging Het
Acad9 T C 3: 36,085,423 S391P probably damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
Cacna1c T C 6: 118,674,584 T972A probably benign Het
Col25a1 G A 3: 130,551,979 G406E probably damaging Het
Coro2b T G 9: 62,429,020 I267L probably benign Het
Cst12 A G 2: 148,789,539 N60S probably benign Het
Dnah8 A T 17: 30,871,419 I4632F probably benign Het
Eif3d C T 15: 77,960,092 C404Y possibly damaging Het
Fam43a A T 16: 30,600,768 K57* probably null Het
Fbrs T C 7: 127,487,784 probably null Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Fggy G A 4: 95,812,144 E351K probably benign Het
Gabra6 G A 11: 42,316,453 S268L probably damaging Het
Gatm A G 2: 122,602,513 Y223H probably damaging Het
Gli3 T A 13: 15,725,991 M1321K probably benign Het
Hira G A 16: 18,947,444 A669T probably benign Het
Hoxa5 T C 6: 52,204,260 S31G probably benign Het
Kdm2a T A 19: 4,389,026 Q25L unknown Het
Loxhd1 C A 18: 77,381,638 N1000K possibly damaging Het
Mpdu1 C T 11: 69,657,243 W235* probably null Het
Msantd2 G C 9: 37,489,493 G57A probably benign Het
Nat1 A G 8: 67,490,998 R9G probably damaging Het
Nbl1 G A 4: 139,083,569 P105S probably damaging Het
Olfr677 A C 7: 105,056,645 Q133P probably damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pdzrn3 T C 6: 101,151,957 S583G probably damaging Het
Prpf4 A G 4: 62,422,629 D427G probably damaging Het
Ptpn21 T A 12: 98,678,582 I1167F possibly damaging Het
Rasgrp1 T A 2: 117,293,812 H303L probably damaging Het
Ros1 T A 10: 52,101,717 K1499* probably null Het
Skida1 C A 2: 18,048,148 L64F probably damaging Het
St3gal5 T C 6: 72,142,191 Y123H probably benign Het
Syk T C 13: 52,624,732 S285P probably benign Het
Syt4 T C 18: 31,444,215 T29A probably benign Het
Trav7-3 A G 14: 53,443,642 D47G possibly damaging Het
Trpm7 A G 2: 126,849,998 F146L probably damaging Het
Utp20 A T 10: 88,798,475 D786E probably benign Het
Uts2 G A 4: 151,001,658 C117Y possibly damaging Het
Zfp553 T C 7: 127,236,296 L341P probably damaging Het
Zfp994 T A 17: 22,200,223 K582* probably null Het
Other mutations in Olfr137
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02131:Olfr137 APN 17 38304648 missense probably benign 0.03
IGL03169:Olfr137 APN 17 38305101 missense probably damaging 1.00
IGL03392:Olfr137 APN 17 38304895 missense probably benign 0.02
R0055:Olfr137 UTSW 17 38304811 missense possibly damaging 0.84
R0055:Olfr137 UTSW 17 38304811 missense possibly damaging 0.84
R0496:Olfr137 UTSW 17 38304658 missense probably damaging 0.99
R0761:Olfr137 UTSW 17 38305391 missense probably benign 0.00
R1126:Olfr137 UTSW 17 38304688 missense probably damaging 0.97
R1835:Olfr137 UTSW 17 38305312 missense probably benign 0.02
R3727:Olfr137 UTSW 17 38305419 missense possibly damaging 0.64
R5556:Olfr137 UTSW 17 38305073 missense possibly damaging 0.71
R5979:Olfr137 UTSW 17 38305192 missense probably benign
R6430:Olfr137 UTSW 17 38305358 missense probably benign 0.04
R6433:Olfr137 UTSW 17 38305413 missense probably damaging 1.00
R7400:Olfr137 UTSW 17 38305331 missense possibly damaging 0.91
R8053:Olfr137 UTSW 17 38305210 missense probably benign
R8446:Olfr137 UTSW 17 38304747 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGGAATGTCACATCCATCG -3'
(R):5'- TGGAGCCCATCTTACTGTTG -3'

Sequencing Primer
(F):5'- GGGAATGTCACATCCATCGAAAGTAC -3'
(R):5'- GGAGCCCATCTTACTGTTGTTTCTC -3'
Posted On2020-07-13