Mutagenetix > Incidental Mutation

Incidental Mutation 'R8200:Abtb2'

635616

Institutional Source

Beutler Lab

Gene Symbol

Abtb2

Ensembl Gene

ENSMUSG00000032724

Gene Name

ankyrin repeat and BTB (POZ) domain containing 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8200 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103566310-103718423 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103700817 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 431 (I431V)

Ref Sequence

ENSEMBL: ENSMUSP00000075566 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076212]

AlphaFold

Q7TQI7

Predicted Effect

probably benign
Transcript: ENSMUST00000076212
AA Change: I431V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: I431V

Domain	Start	End	E-Value	Type
low complexity region	29	48	N/A	INTRINSIC
low complexity region	122	143	N/A	INTRINSIC
Blast:H2A	186	301	2e-38	BLAST
low complexity region	366	376	N/A	INTRINSIC
ANK	521	550	4.78e-7	SMART
ANK	567	596	6.26e-2	SMART
ANK	606	635	3.65e-3	SMART
ANK	649	678	5.52e2	SMART
ANK	715	746	1.84e3	SMART
BTB	844	946	9.15e-24	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.3%

Validation Efficiency

100% (38/38)

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930555G01Rik	T	A	14: 5,052,797	M132K	probably benign	Het
Ache	A	G	5: 137,294,195	Q601R	probably damaging	Het
Ap3d1	A	T	10: 80,722,932	C279*	probably null	Het
Brms1l	T	C	12: 55,844,398	L79P	probably damaging	Het
Brpf3	C	T	17: 28,806,274	A107V	probably benign	Het
Catsperd	T	C	17: 56,632,368		probably null	Het
Ccnb1ip1	C	T	14: 50,792,293	R104H	probably benign	Het
Ces1g	T	A	8: 93,328,457	N204I	probably damaging	Het
Cmbl	T	C	15: 31,585,393	V141A	probably benign	Het
Dmxl2	A	T	9: 54,480,346	H69Q	probably benign	Het
Dnah10	T	C	5: 124,828,460	L4113P	probably damaging	Het
Fam120a	T	C	13: 48,949,119	H220R	probably damaging	Het
Flvcr2	GTAGTGTATA	GTA	12: 85,803,148		probably null	Het
Gm43218	C	T	6: 70,240,544	G76E	probably damaging	Het
Gypa	A	T	8: 80,494,066	T5S	unknown	Het
Hyal6	A	G	6: 24,734,566	D166G	probably benign	Het
Immt	T	A	6: 71,871,437	V470D	probably damaging	Het
Itpr1	A	G	6: 108,394,865	S1167G	probably benign	Het
Ndufs1	A	T	1: 63,170,172		probably null	Het
Nr1i3	C	A	1: 171,217,697	H305N	probably benign	Het
Nucb2	T	C	7: 116,533,163		probably null	Het
Plau	A	C	14: 20,839,113	K130T	possibly damaging	Het
Ppef2	A	T	5: 92,245,392	V246E	probably benign	Het
Prune2	G	A	19: 17,124,973	V2499I	probably benign	Het
Rnf207	C	T	4: 152,314,035		probably null	Het
Sept9	A	G	11: 117,232,716	T7A	probably benign	Het
Sh3bp5l	T	C	11: 58,331,859	I60T	probably damaging	Het
Taar9	A	G	10: 24,109,419	L39P	probably damaging	Het
Tcl1b5	A	T	12: 105,178,953	M59L	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Thap2	A	T	10: 115,376,487	F44L		Het
Trp53bp1	A	G	2: 121,236,176	S690P	probably benign	Het
Ttc9	T	C	12: 81,660,661	Y165H	probably damaging	Het
Ttll11	A	G	2: 35,944,928	I162T	probably damaging	Het
Ttll5	T	A	12: 85,879,410	I326N	probably damaging	Het
Tuft1	A	T	3: 94,616,670	D292E	probably damaging	Het
Ubap2l	T	C	3: 90,023,626	S365G	probably benign	Het
Ugt2b37	G	A	5: 87,240,891	Q488*	probably null	Het
Vmo1	A	G	11: 70,514,499	V35A	possibly damaging	Het
Wdr36	A	G	18: 32,865,926	K875R	probably benign	Het

Other mutations in Abtb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01161:Abtb2	APN	2	103705118	missense	probably benign	0.00
IGL02605:Abtb2	APN	2	103717257	missense	probably benign
IGL03161:Abtb2	APN	2	103567454	missense	probably benign	0.02
PIT4504001:Abtb2	UTSW	2	103717192	nonsense	probably null
R0147:Abtb2	UTSW	2	103567135	missense	probably benign	0.04
R1052:Abtb2	UTSW	2	103705072	missense	possibly damaging	0.46
R1419:Abtb2	UTSW	2	103709420	missense	probably benign	0.00
R1518:Abtb2	UTSW	2	103709284	missense	probably benign	0.03
R1650:Abtb2	UTSW	2	103702402	missense	probably damaging	1.00
R1795:Abtb2	UTSW	2	103567024	missense	probably benign	0.00
R2054:Abtb2	UTSW	2	103705117	missense	probably benign	0.41
R2101:Abtb2	UTSW	2	103566862	missense	probably benign	0.05
R2363:Abtb2	UTSW	2	103567183	missense	probably damaging	1.00
R3440:Abtb2	UTSW	2	103567232	missense	probably benign	0.43
R3927:Abtb2	UTSW	2	103708218	splice site	probably null
R4351:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4352:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4782:Abtb2	UTSW	2	103717299	missense	probably benign	0.35
R4814:Abtb2	UTSW	2	103717287	missense	probably benign	0.08
R4831:Abtb2	UTSW	2	103683475	missense	probably benign	0.06
R4900:Abtb2	UTSW	2	103567004	missense	possibly damaging	0.62
R5038:Abtb2	UTSW	2	103567063	missense	probably damaging	0.99
R5513:Abtb2	UTSW	2	103709278	critical splice acceptor site	probably null
R6119:Abtb2	UTSW	2	103702310	missense	probably benign	0.00
R6298:Abtb2	UTSW	2	103709488	missense	probably benign	0.10
R6383:Abtb2	UTSW	2	103567376	missense	probably damaging	0.98
R6860:Abtb2	UTSW	2	103709425	nonsense	probably null
R7000:Abtb2	UTSW	2	103712442	missense	possibly damaging	0.85
R7109:Abtb2	UTSW	2	103715515	missense	probably benign	0.20
R7176:Abtb2	UTSW	2	103709375	missense	probably benign	0.00
R7189:Abtb2	UTSW	2	103567516	missense	probably benign	0.00
R7199:Abtb2	UTSW	2	103567220	missense	possibly damaging	0.74
R7299:Abtb2	UTSW	2	103702424	splice site	probably null
R7347:Abtb2	UTSW	2	103567412	missense	probably damaging	1.00
R7469:Abtb2	UTSW	2	103566947	missense	probably benign	0.00
R7629:Abtb2	UTSW	2	103683493	critical splice donor site	probably null
R7862:Abtb2	UTSW	2	103702281	missense	probably damaging	1.00
R8682:Abtb2	UTSW	2	103567375	missense	probably benign	0.36
R8700:Abtb2	UTSW	2	103566944	missense	probably damaging	0.99
R9164:Abtb2	UTSW	2	103711484	missense	possibly damaging	0.50
R9196:Abtb2	UTSW	2	103683302	missense	possibly damaging	0.71
R9254:Abtb2	UTSW	2	103711235	missense	probably benign	0.00
R9258:Abtb2	UTSW	2	103716065	missense	probably null	0.99
R9343:Abtb2	UTSW	2	103717160	missense	probably benign
R9427:Abtb2	UTSW	2	103700899	missense	probably damaging	1.00
R9675:Abtb2	UTSW	2	103708187	missense	probably benign
Z1176:Abtb2	UTSW	2	103708172	nonsense	probably null
Z1177:Abtb2	UTSW	2	103711196	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTGGCACTGTCCTTTCATGG -3'
(R):5'- CCTACAGCCTTGCTCTGATG -3'

Sequencing Primer
(F):5'- GTCCTTTCATGGATAAAGCAGCGC -3'
(R):5'- TGCTCTGATGCCCACCCAG -3'

Posted On

2020-07-13