Incidental Mutation 'R8200:Rnf207'
ID635620
Institutional Source Beutler Lab
Gene Symbol Rnf207
Ensembl Gene ENSMUSG00000058498
Gene Namering finger protein 207
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R8200 (G1)
Quality Score184.009
Status Validated
Chromosome4
Chromosomal Location152307019-152318993 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 152314035 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076183] [ENSMUST00000130008] [ENSMUST00000170820]
Predicted Effect probably null
Transcript: ENSMUST00000076183
SMART Domains Protein: ENSMUSP00000075540
Gene: ENSMUSG00000058498

DomainStartEndE-ValueType
RING 25 63 1.16e-5 SMART
Pfam:zf-B_box 93 145 3.6e-11 PFAM
Pfam:DUF3583 204 378 1.2e-10 PFAM
coiled coil region 422 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130008
SMART Domains Protein: ENSMUSP00000127196
Gene: ENSMUSG00000058498

DomainStartEndE-ValueType
RING 25 63 5.6e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170820
SMART Domains Protein: ENSMUSP00000129400
Gene: ENSMUSG00000058498

DomainStartEndE-ValueType
RING 25 63 1.16e-5 SMART
Pfam:zf-B_box 93 145 1e-11 PFAM
low complexity region 236 242 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
coiled coil region 387 426 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.3%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930555G01Rik T A 14: 5,052,797 M132K probably benign Het
Abtb2 A G 2: 103,700,817 I431V probably benign Het
Ache A G 5: 137,294,195 Q601R probably damaging Het
Ap3d1 A T 10: 80,722,932 C279* probably null Het
Brms1l T C 12: 55,844,398 L79P probably damaging Het
Brpf3 C T 17: 28,806,274 A107V probably benign Het
Catsperd T C 17: 56,632,368 probably null Het
Ccnb1ip1 C T 14: 50,792,293 R104H probably benign Het
Ces1g T A 8: 93,328,457 N204I probably damaging Het
Cmbl T C 15: 31,585,393 V141A probably benign Het
Dmxl2 A T 9: 54,480,346 H69Q probably benign Het
Dnah10 T C 5: 124,828,460 L4113P probably damaging Het
Fam120a T C 13: 48,949,119 H220R probably damaging Het
Gm43218 C T 6: 70,240,544 G76E probably damaging Het
Gypa A T 8: 80,494,066 T5S unknown Het
Hyal6 A G 6: 24,734,566 D166G probably benign Het
Immt T A 6: 71,871,437 V470D probably damaging Het
Itpr1 A G 6: 108,394,865 S1167G probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Ndufs1 A T 1: 63,170,172 probably null Het
Nr1i3 C A 1: 171,217,697 H305N probably benign Het
Nucb2 T C 7: 116,533,163 probably null Het
Plau A C 14: 20,839,113 K130T possibly damaging Het
Ppef2 A T 5: 92,245,392 V246E probably benign Het
Prune2 G A 19: 17,124,973 V2499I probably benign Het
Sept9 A G 11: 117,232,716 T7A probably benign Het
Sh3bp5l T C 11: 58,331,859 I60T probably damaging Het
Taar9 A G 10: 24,109,419 L39P probably damaging Het
Tcl1b5 A T 12: 105,178,953 M59L probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Thap2 A T 10: 115,376,487 F44L Het
Trp53bp1 A G 2: 121,236,176 S690P probably benign Het
Ttc9 T C 12: 81,660,661 Y165H probably damaging Het
Ttll11 A G 2: 35,944,928 I162T probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Tuft1 A T 3: 94,616,670 D292E probably damaging Het
Ubap2l T C 3: 90,023,626 S365G probably benign Het
Ugt2b37 G A 5: 87,240,891 Q488* probably null Het
Vmo1 A G 11: 70,514,499 V35A possibly damaging Het
Wdr36 A G 18: 32,865,926 K875R probably benign Het
Other mutations in Rnf207
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01643:Rnf207 APN 4 152318261 splice site probably benign
IGL02325:Rnf207 APN 4 152311780 missense probably damaging 0.97
IGL02451:Rnf207 APN 4 152312412 missense probably benign 0.25
felonius UTSW 4 152311780 missense probably damaging 0.98
perjury UTSW 4 152313215 missense probably benign 0.00
R0311:Rnf207 UTSW 4 152315779 missense probably damaging 1.00
R0462:Rnf207 UTSW 4 152313372 missense possibly damaging 0.78
R0671:Rnf207 UTSW 4 152307468 missense probably benign 0.00
R0845:Rnf207 UTSW 4 152312064 splice site probably benign
R1544:Rnf207 UTSW 4 152313871 splice site probably benign
R1667:Rnf207 UTSW 4 152313215 missense probably benign 0.00
R4052:Rnf207 UTSW 4 152311437 missense probably benign 0.41
R4335:Rnf207 UTSW 4 152315605 splice site probably benign
R4649:Rnf207 UTSW 4 152312155 missense probably benign 0.06
R5033:Rnf207 UTSW 4 152313209 missense probably benign 0.00
R5268:Rnf207 UTSW 4 152313889 missense probably damaging 1.00
R5603:Rnf207 UTSW 4 152312394 missense probably damaging 1.00
R5938:Rnf207 UTSW 4 152317928 intron probably benign
R6147:Rnf207 UTSW 4 152315655 missense probably damaging 1.00
R6181:Rnf207 UTSW 4 152308848 missense probably benign 0.00
R6866:Rnf207 UTSW 4 152312532 missense possibly damaging 0.81
R7166:Rnf207 UTSW 4 152311780 missense probably damaging 0.98
R7177:Rnf207 UTSW 4 152312177 missense probably benign 0.43
R7354:Rnf207 UTSW 4 152314091 missense probably damaging 0.96
R7893:Rnf207 UTSW 4 152311438 missense probably damaging 0.99
R8789:Rnf207 UTSW 4 152307467 missense probably benign 0.04
X0026:Rnf207 UTSW 4 152316042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGTTGGAGACACTCACATAAC -3'
(R):5'- TATGCATCCTGCCACACAG -3'

Sequencing Primer
(F):5'- CCCAAATCCAGAAACTCAGCTTTG -3'
(R):5'- GGCACACAATGTAACACACAC -3'
Posted On2020-07-13