Mutagenetix > Incidental Mutation

Incidental Mutation 'R8200:Ppef2'

635622

Institutional Source

Beutler Lab

Gene Symbol

Ppef2

Ensembl Gene

ENSMUSG00000029410

Gene Name

protein phosphatase, EF hand calcium-binding domain 2

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8200 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92226679-92256278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 92245392 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 246 (V246E)

Ref Sequence

ENSEMBL: ENSMUSP00000031359 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031359] [ENSMUST00000201130]

AlphaFold

O35385

Predicted Effect

probably benign
Transcript: ENSMUST00000031359
AA Change: V246E

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000031359
Gene: ENSMUSG00000029410
AA Change: V246E

Domain	Start	End	E-Value	Type
IQ	18	40	3.48e-1	SMART
PP2Ac	141	544	1.97e-118	SMART
EFh	576	604	3.25e1	SMART
EFh	660	688	5.44e-3	SMART
EFh	700	728	1.67e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000201130
AA Change: V246E

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000144157
Gene: ENSMUSG00000029410
AA Change: V246E

Domain	Start	End	E-Value	Type
IQ	18	40	3.48e-1	SMART
PP2Ac	141	544	1.97e-118	SMART
EFh	576	604	3.25e1	SMART
EFh	660	688	5.44e-3	SMART
EFh	700	728	1.67e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.3%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein phosphatase with EF-hand motif family. The protein contains a protein phosphatase catalytic domain, and at least two EF-hand calcium-binding motifs in its C terminus. Although its substrate(s) is unknown, the encoded protein, which is expressed specifically in photoreceptors and the pineal, has been suggested to play a role in the visual system. This gene shares high sequence similarity with the Drosophila retinal degeneration C (rdgC) gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation appear to be phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930555G01Rik	T	A	14: 5,052,797	M132K	probably benign	Het
Abtb2	A	G	2: 103,700,817	I431V	probably benign	Het
Ache	A	G	5: 137,294,195	Q601R	probably damaging	Het
Ap3d1	A	T	10: 80,722,932	C279*	probably null	Het
Brms1l	T	C	12: 55,844,398	L79P	probably damaging	Het
Brpf3	C	T	17: 28,806,274	A107V	probably benign	Het
Catsperd	T	C	17: 56,632,368		probably null	Het
Ccnb1ip1	C	T	14: 50,792,293	R104H	probably benign	Het
Ces1g	T	A	8: 93,328,457	N204I	probably damaging	Het
Cmbl	T	C	15: 31,585,393	V141A	probably benign	Het
Dmxl2	A	T	9: 54,480,346	H69Q	probably benign	Het
Dnah10	T	C	5: 124,828,460	L4113P	probably damaging	Het
Fam120a	T	C	13: 48,949,119	H220R	probably damaging	Het
Gm43218	C	T	6: 70,240,544	G76E	probably damaging	Het
Gypa	A	T	8: 80,494,066	T5S	unknown	Het
Hyal6	A	G	6: 24,734,566	D166G	probably benign	Het
Immt	T	A	6: 71,871,437	V470D	probably damaging	Het
Itpr1	A	G	6: 108,394,865	S1167G	probably benign	Het
Mfsd7c	GTAGTGTATA	GTA	12: 85,803,148		probably null	Het
Ndufs1	A	T	1: 63,170,172		probably null	Het
Nr1i3	C	A	1: 171,217,697	H305N	probably benign	Het
Nucb2	T	C	7: 116,533,163		probably null	Het
Plau	A	C	14: 20,839,113	K130T	possibly damaging	Het
Prune2	G	A	19: 17,124,973	V2499I	probably benign	Het
Rnf207	C	T	4: 152,314,035		probably null	Het
Sept9	A	G	11: 117,232,716	T7A	probably benign	Het
Sh3bp5l	T	C	11: 58,331,859	I60T	probably damaging	Het
Taar9	A	G	10: 24,109,419	L39P	probably damaging	Het
Tcl1b5	A	T	12: 105,178,953	M59L	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Thap2	A	T	10: 115,376,487	F44L		Het
Trp53bp1	A	G	2: 121,236,176	S690P	probably benign	Het
Ttc9	T	C	12: 81,660,661	Y165H	probably damaging	Het
Ttll11	A	G	2: 35,944,928	I162T	probably damaging	Het
Ttll5	T	A	12: 85,879,410	I326N	probably damaging	Het
Tuft1	A	T	3: 94,616,670	D292E	probably damaging	Het
Ubap2l	T	C	3: 90,023,626	S365G	probably benign	Het
Ugt2b37	G	A	5: 87,240,891	Q488*	probably null	Het
Vmo1	A	G	11: 70,514,499	V35A	possibly damaging	Het
Wdr36	A	G	18: 32,865,926	K875R	probably benign	Het

Other mutations in Ppef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01066:Ppef2	APN	5	92234237	missense	probably damaging	1.00
IGL01105:Ppef2	APN	5	92249196	missense	possibly damaging	0.91
IGL01613:Ppef2	APN	5	92235820	missense	probably benign	0.01
IGL01793:Ppef2	APN	5	92246756	missense	probably damaging	1.00
IGL02529:Ppef2	APN	5	92244737	missense	probably damaging	1.00
IGL02702:Ppef2	APN	5	92231819	missense	probably benign	0.01
IGL02992:Ppef2	APN	5	92235900	nonsense	probably null
IGL02995:Ppef2	APN	5	92235900	nonsense	probably null
IGL02996:Ppef2	APN	5	92235900	nonsense	probably null
IGL03169:Ppef2	APN	5	92235900	nonsense	probably null
IGL02991:Ppef2	UTSW	5	92235900	nonsense	probably null
R0494:Ppef2	UTSW	5	92253093	splice site	probably benign
R0659:Ppef2	UTSW	5	92230509	missense	probably damaging	1.00
R0781:Ppef2	UTSW	5	92244830	missense	probably benign	0.39
R1162:Ppef2	UTSW	5	92253121	missense	probably benign	0.00
R1870:Ppef2	UTSW	5	92250512	missense	probably damaging	1.00
R2212:Ppef2	UTSW	5	92228722	missense	probably damaging	0.97
R2973:Ppef2	UTSW	5	92239094	missense	probably benign
R3412:Ppef2	UTSW	5	92228722	missense	probably damaging	0.97
R3413:Ppef2	UTSW	5	92228722	missense	probably damaging	0.97
R3745:Ppef2	UTSW	5	92239151	splice site	probably benign
R4878:Ppef2	UTSW	5	92228740	splice site	probably null
R5027:Ppef2	UTSW	5	92234291	missense	probably damaging	1.00
R5156:Ppef2	UTSW	5	92244602	critical splice donor site	probably null
R5316:Ppef2	UTSW	5	92235811	missense	probably benign	0.00
R5590:Ppef2	UTSW	5	92239139	missense	probably damaging	0.99
R5773:Ppef2	UTSW	5	92250561	missense	probably damaging	1.00
R5881:Ppef2	UTSW	5	92250529	nonsense	probably null
R6032:Ppef2	UTSW	5	92230524	missense	probably benign	0.23
R6032:Ppef2	UTSW	5	92230524	missense	probably benign	0.23
R6182:Ppef2	UTSW	5	92227066	missense	probably damaging	1.00
R6335:Ppef2	UTSW	5	92235754	missense	probably damaging	1.00
R6645:Ppef2	UTSW	5	92230461	missense	probably benign	0.02
R7448:Ppef2	UTSW	5	92228704	missense	probably damaging	1.00
R7576:Ppef2	UTSW	5	92253134	missense	possibly damaging	0.87
R7968:Ppef2	UTSW	5	92249163	missense	probably damaging	0.99
R7988:Ppef2	UTSW	5	92238982	missense	probably benign	0.00
R8212:Ppef2	UTSW	5	92228665	missense	possibly damaging	0.87
R9687:Ppef2	UTSW	5	92238887	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CTGTGTGGATCCTTATAGTTTACAAGC -3'
(R):5'- GTGAACTCATCATCGGTCGG -3'

Sequencing Primer
(F):5'- CACAATAGTAAAATAACATGGaat -3'
(R):5'- TCATCATCGGTCGGAAGAAC -3'

Posted On

2020-07-13