Incidental Mutation 'R8200:Ppef2'
ID 635622
Institutional Source Beutler Lab
Gene Symbol Ppef2
Ensembl Gene ENSMUSG00000029410
Gene Name protein phosphatase, EF hand calcium-binding domain 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8200 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 92226679-92256278 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 92245392 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 246 (V246E)
Ref Sequence ENSEMBL: ENSMUSP00000031359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031359] [ENSMUST00000201130]
AlphaFold O35385
Predicted Effect probably benign
Transcript: ENSMUST00000031359
AA Change: V246E

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000031359
Gene: ENSMUSG00000029410
AA Change: V246E

DomainStartEndE-ValueType
IQ 18 40 3.48e-1 SMART
PP2Ac 141 544 1.97e-118 SMART
EFh 576 604 3.25e1 SMART
EFh 660 688 5.44e-3 SMART
EFh 700 728 1.67e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201130
AA Change: V246E

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144157
Gene: ENSMUSG00000029410
AA Change: V246E

DomainStartEndE-ValueType
IQ 18 40 3.48e-1 SMART
PP2Ac 141 544 1.97e-118 SMART
EFh 576 604 3.25e1 SMART
EFh 660 688 5.44e-3 SMART
EFh 700 728 1.67e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.3%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein phosphatase with EF-hand motif family. The protein contains a protein phosphatase catalytic domain, and at least two EF-hand calcium-binding motifs in its C terminus. Although its substrate(s) is unknown, the encoded protein, which is expressed specifically in photoreceptors and the pineal, has been suggested to play a role in the visual system. This gene shares high sequence similarity with the Drosophila retinal degeneration C (rdgC) gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation appear to be phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930555G01Rik T A 14: 5,052,797 M132K probably benign Het
Abtb2 A G 2: 103,700,817 I431V probably benign Het
Ache A G 5: 137,294,195 Q601R probably damaging Het
Ap3d1 A T 10: 80,722,932 C279* probably null Het
Brms1l T C 12: 55,844,398 L79P probably damaging Het
Brpf3 C T 17: 28,806,274 A107V probably benign Het
Catsperd T C 17: 56,632,368 probably null Het
Ccnb1ip1 C T 14: 50,792,293 R104H probably benign Het
Ces1g T A 8: 93,328,457 N204I probably damaging Het
Cmbl T C 15: 31,585,393 V141A probably benign Het
Dmxl2 A T 9: 54,480,346 H69Q probably benign Het
Dnah10 T C 5: 124,828,460 L4113P probably damaging Het
Fam120a T C 13: 48,949,119 H220R probably damaging Het
Gm43218 C T 6: 70,240,544 G76E probably damaging Het
Gypa A T 8: 80,494,066 T5S unknown Het
Hyal6 A G 6: 24,734,566 D166G probably benign Het
Immt T A 6: 71,871,437 V470D probably damaging Het
Itpr1 A G 6: 108,394,865 S1167G probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Ndufs1 A T 1: 63,170,172 probably null Het
Nr1i3 C A 1: 171,217,697 H305N probably benign Het
Nucb2 T C 7: 116,533,163 probably null Het
Plau A C 14: 20,839,113 K130T possibly damaging Het
Prune2 G A 19: 17,124,973 V2499I probably benign Het
Rnf207 C T 4: 152,314,035 probably null Het
Sept9 A G 11: 117,232,716 T7A probably benign Het
Sh3bp5l T C 11: 58,331,859 I60T probably damaging Het
Taar9 A G 10: 24,109,419 L39P probably damaging Het
Tcl1b5 A T 12: 105,178,953 M59L probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Thap2 A T 10: 115,376,487 F44L Het
Trp53bp1 A G 2: 121,236,176 S690P probably benign Het
Ttc9 T C 12: 81,660,661 Y165H probably damaging Het
Ttll11 A G 2: 35,944,928 I162T probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Tuft1 A T 3: 94,616,670 D292E probably damaging Het
Ubap2l T C 3: 90,023,626 S365G probably benign Het
Ugt2b37 G A 5: 87,240,891 Q488* probably null Het
Vmo1 A G 11: 70,514,499 V35A possibly damaging Het
Wdr36 A G 18: 32,865,926 K875R probably benign Het
Other mutations in Ppef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Ppef2 APN 5 92234237 missense probably damaging 1.00
IGL01105:Ppef2 APN 5 92249196 missense possibly damaging 0.91
IGL01613:Ppef2 APN 5 92235820 missense probably benign 0.01
IGL01793:Ppef2 APN 5 92246756 missense probably damaging 1.00
IGL02529:Ppef2 APN 5 92244737 missense probably damaging 1.00
IGL02702:Ppef2 APN 5 92231819 missense probably benign 0.01
IGL02992:Ppef2 APN 5 92235900 nonsense probably null
IGL02995:Ppef2 APN 5 92235900 nonsense probably null
IGL02996:Ppef2 APN 5 92235900 nonsense probably null
IGL03169:Ppef2 APN 5 92235900 nonsense probably null
IGL02991:Ppef2 UTSW 5 92235900 nonsense probably null
R0494:Ppef2 UTSW 5 92253093 splice site probably benign
R0659:Ppef2 UTSW 5 92230509 missense probably damaging 1.00
R0781:Ppef2 UTSW 5 92244830 missense probably benign 0.39
R1162:Ppef2 UTSW 5 92253121 missense probably benign 0.00
R1870:Ppef2 UTSW 5 92250512 missense probably damaging 1.00
R2212:Ppef2 UTSW 5 92228722 missense probably damaging 0.97
R2973:Ppef2 UTSW 5 92239094 missense probably benign
R3412:Ppef2 UTSW 5 92228722 missense probably damaging 0.97
R3413:Ppef2 UTSW 5 92228722 missense probably damaging 0.97
R3745:Ppef2 UTSW 5 92239151 splice site probably benign
R4878:Ppef2 UTSW 5 92228740 splice site probably null
R5027:Ppef2 UTSW 5 92234291 missense probably damaging 1.00
R5156:Ppef2 UTSW 5 92244602 critical splice donor site probably null
R5316:Ppef2 UTSW 5 92235811 missense probably benign 0.00
R5590:Ppef2 UTSW 5 92239139 missense probably damaging 0.99
R5773:Ppef2 UTSW 5 92250561 missense probably damaging 1.00
R5881:Ppef2 UTSW 5 92250529 nonsense probably null
R6032:Ppef2 UTSW 5 92230524 missense probably benign 0.23
R6032:Ppef2 UTSW 5 92230524 missense probably benign 0.23
R6182:Ppef2 UTSW 5 92227066 missense probably damaging 1.00
R6335:Ppef2 UTSW 5 92235754 missense probably damaging 1.00
R6645:Ppef2 UTSW 5 92230461 missense probably benign 0.02
R7448:Ppef2 UTSW 5 92228704 missense probably damaging 1.00
R7576:Ppef2 UTSW 5 92253134 missense possibly damaging 0.87
R7968:Ppef2 UTSW 5 92249163 missense probably damaging 0.99
R7988:Ppef2 UTSW 5 92238982 missense probably benign 0.00
R8212:Ppef2 UTSW 5 92228665 missense possibly damaging 0.87
R9687:Ppef2 UTSW 5 92238887 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGTGTGGATCCTTATAGTTTACAAGC -3'
(R):5'- GTGAACTCATCATCGGTCGG -3'

Sequencing Primer
(F):5'- CACAATAGTAAAATAACATGGaat -3'
(R):5'- TCATCATCGGTCGGAAGAAC -3'
Posted On 2020-07-13