Incidental Mutation 'R8200:Taar9'
ID635633
Institutional Source Beutler Lab
Gene Symbol Taar9
Ensembl Gene ENSMUSG00000037424
Gene Nametrace amine-associated receptor 9
SynonymsTar3, Ta3, Trar3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R8200 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location24108488-24109534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24109419 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 39 (L39P)
Ref Sequence ENSEMBL: ENSMUSP00000043552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041180]
Predicted Effect probably damaging
Transcript: ENSMUST00000041180
AA Change: L39P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043552
Gene: ENSMUSG00000037424
AA Change: L39P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 326 7.3e-13 PFAM
Pfam:7tm_1 49 311 8.4e-61 PFAM
Meta Mutation Damage Score 0.1919 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.3%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TAAR9 is a member of a large family of rhodopsin G protein-coupled receptors (GPCRs, or GPRs). GPCRs contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins.[supplied by OMIM, Jul 2005]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930555G01Rik T A 14: 5,052,797 M132K probably benign Het
Abtb2 A G 2: 103,700,817 I431V probably benign Het
Ache A G 5: 137,294,195 Q601R probably damaging Het
Ap3d1 A T 10: 80,722,932 C279* probably null Het
Brms1l T C 12: 55,844,398 L79P probably damaging Het
Brpf3 C T 17: 28,806,274 A107V probably benign Het
Catsperd T C 17: 56,632,368 probably null Het
Ccnb1ip1 C T 14: 50,792,293 R104H probably benign Het
Ces1g T A 8: 93,328,457 N204I probably damaging Het
Cmbl T C 15: 31,585,393 V141A probably benign Het
Dmxl2 A T 9: 54,480,346 H69Q probably benign Het
Dnah10 T C 5: 124,828,460 L4113P probably damaging Het
Fam120a T C 13: 48,949,119 H220R probably damaging Het
Gm43218 C T 6: 70,240,544 G76E probably damaging Het
Gypa A T 8: 80,494,066 T5S unknown Het
Hyal6 A G 6: 24,734,566 D166G probably benign Het
Immt T A 6: 71,871,437 V470D probably damaging Het
Itpr1 A G 6: 108,394,865 S1167G probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Ndufs1 A T 1: 63,170,172 probably null Het
Nr1i3 C A 1: 171,217,697 H305N probably benign Het
Nucb2 T C 7: 116,533,163 probably null Het
Plau A C 14: 20,839,113 K130T possibly damaging Het
Ppef2 A T 5: 92,245,392 V246E probably benign Het
Prune2 G A 19: 17,124,973 V2499I probably benign Het
Rnf207 C T 4: 152,314,035 probably null Het
Sept9 A G 11: 117,232,716 T7A probably benign Het
Sh3bp5l T C 11: 58,331,859 I60T probably damaging Het
Tcl1b5 A T 12: 105,178,953 M59L probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Thap2 A T 10: 115,376,487 F44L Het
Trp53bp1 A G 2: 121,236,176 S690P probably benign Het
Ttc9 T C 12: 81,660,661 Y165H probably damaging Het
Ttll11 A G 2: 35,944,928 I162T probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Tuft1 A T 3: 94,616,670 D292E probably damaging Het
Ubap2l T C 3: 90,023,626 S365G probably benign Het
Ugt2b37 G A 5: 87,240,891 Q488* probably null Het
Vmo1 A G 11: 70,514,499 V35A possibly damaging Het
Wdr36 A G 18: 32,865,926 K875R probably benign Het
Other mutations in Taar9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Taar9 APN 10 24109531 missense probably benign
IGL02011:Taar9 APN 10 24108579 missense possibly damaging 0.93
IGL02883:Taar9 APN 10 24109480 missense probably benign 0.08
R1468:Taar9 UTSW 10 24109484 missense possibly damaging 0.47
R1468:Taar9 UTSW 10 24109484 missense possibly damaging 0.47
R1598:Taar9 UTSW 10 24109407 missense possibly damaging 0.90
R2072:Taar9 UTSW 10 24108979 missense probably damaging 1.00
R2471:Taar9 UTSW 10 24109391 missense probably benign 0.00
R2519:Taar9 UTSW 10 24109254 missense probably damaging 1.00
R4205:Taar9 UTSW 10 24108579 missense possibly damaging 0.93
R4793:Taar9 UTSW 10 24109510 missense probably benign
R4801:Taar9 UTSW 10 24108843 missense probably damaging 0.97
R4802:Taar9 UTSW 10 24108843 missense probably damaging 0.97
R5457:Taar9 UTSW 10 24109105 missense probably damaging 0.98
R6450:Taar9 UTSW 10 24109240 missense probably damaging 1.00
R6601:Taar9 UTSW 10 24109047 missense probably damaging 1.00
R6915:Taar9 UTSW 10 24109012 missense possibly damaging 0.53
R7179:Taar9 UTSW 10 24108984 missense probably damaging 1.00
R7480:Taar9 UTSW 10 24108945 missense possibly damaging 0.61
Z1088:Taar9 UTSW 10 24108965 missense probably damaging 1.00
Z1177:Taar9 UTSW 10 24109141 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGTACCGGTCAATGGAGATG -3'
(R):5'- GCTTTAGATTGCTAGAATGGAAACC -3'

Sequencing Primer
(F):5'- CACGTGTGGAACTTACAGTAACTCTC -3'
(R):5'- CCTGGGAAGTTTACAATTACCAAGAC -3'
Posted On2020-07-13