Incidental Mutation 'R8200:Ap3d1'
ID635634
Institutional Source Beutler Lab
Gene Symbol Ap3d1
Ensembl Gene ENSMUSG00000020198
Gene Nameadaptor-related protein complex 3, delta 1 subunit
SynonymsmBLVR1, Bolvr
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock #R8200 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80706956-80742264 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 80722932 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 279 (C279*)
Ref Sequence ENSEMBL: ENSMUSP00000020420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020420]
Predicted Effect probably null
Transcript: ENSMUST00000020420
AA Change: C279*
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: C279*

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.3%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930555G01Rik T A 14: 5,052,797 M132K probably benign Het
Abtb2 A G 2: 103,700,817 I431V probably benign Het
Ache A G 5: 137,294,195 Q601R probably damaging Het
Brms1l T C 12: 55,844,398 L79P probably damaging Het
Brpf3 C T 17: 28,806,274 A107V probably benign Het
Catsperd T C 17: 56,632,368 probably null Het
Ccnb1ip1 C T 14: 50,792,293 R104H probably benign Het
Ces1g T A 8: 93,328,457 N204I probably damaging Het
Cmbl T C 15: 31,585,393 V141A probably benign Het
Dmxl2 A T 9: 54,480,346 H69Q probably benign Het
Dnah10 T C 5: 124,828,460 L4113P probably damaging Het
Fam120a T C 13: 48,949,119 H220R probably damaging Het
Gm43218 C T 6: 70,240,544 G76E probably damaging Het
Gypa A T 8: 80,494,066 T5S unknown Het
Hyal6 A G 6: 24,734,566 D166G probably benign Het
Immt T A 6: 71,871,437 V470D probably damaging Het
Itpr1 A G 6: 108,394,865 S1167G probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Ndufs1 A T 1: 63,170,172 probably null Het
Nr1i3 C A 1: 171,217,697 H305N probably benign Het
Nucb2 T C 7: 116,533,163 probably null Het
Plau A C 14: 20,839,113 K130T possibly damaging Het
Ppef2 A T 5: 92,245,392 V246E probably benign Het
Prune2 G A 19: 17,124,973 V2499I probably benign Het
Rnf207 C T 4: 152,314,035 probably null Het
Sept9 A G 11: 117,232,716 T7A probably benign Het
Sh3bp5l T C 11: 58,331,859 I60T probably damaging Het
Taar9 A G 10: 24,109,419 L39P probably damaging Het
Tcl1b5 A T 12: 105,178,953 M59L probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Thap2 A T 10: 115,376,487 F44L Het
Trp53bp1 A G 2: 121,236,176 S690P probably benign Het
Ttc9 T C 12: 81,660,661 Y165H probably damaging Het
Ttll11 A G 2: 35,944,928 I162T probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Tuft1 A T 3: 94,616,670 D292E probably damaging Het
Ubap2l T C 3: 90,023,626 S365G probably benign Het
Ugt2b37 G A 5: 87,240,891 Q488* probably null Het
Vmo1 A G 11: 70,514,499 V35A possibly damaging Het
Wdr36 A G 18: 32,865,926 K875R probably benign Het
Other mutations in Ap3d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ap3d1 APN 10 80741979 missense probably benign 0.00
IGL00827:Ap3d1 APN 10 80713559 missense possibly damaging 0.92
IGL01668:Ap3d1 APN 10 80719159 missense possibly damaging 0.95
IGL01934:Ap3d1 APN 10 80709258 nonsense probably null
IGL03404:Ap3d1 APN 10 80730037 missense probably damaging 1.00
christian UTSW 10 80730042 missense probably damaging 1.00
R0119:Ap3d1 UTSW 10 80723615 splice site probably benign
R0197:Ap3d1 UTSW 10 80730042 missense probably damaging 1.00
R0356:Ap3d1 UTSW 10 80727978 missense probably damaging 1.00
R0372:Ap3d1 UTSW 10 80723567 missense probably damaging 1.00
R0491:Ap3d1 UTSW 10 80719241 missense probably damaging 1.00
R0636:Ap3d1 UTSW 10 80719382 nonsense probably null
R0792:Ap3d1 UTSW 10 80708479 missense probably benign
R0942:Ap3d1 UTSW 10 80732955 splice site probably benign
R1015:Ap3d1 UTSW 10 80716489 missense probably damaging 1.00
R1023:Ap3d1 UTSW 10 80714258 missense probably damaging 1.00
R1170:Ap3d1 UTSW 10 80732840 splice site probably benign
R1540:Ap3d1 UTSW 10 80715941 missense probably benign 0.00
R1639:Ap3d1 UTSW 10 80730010 missense probably damaging 0.98
R1664:Ap3d1 UTSW 10 80717737 nonsense probably null
R1669:Ap3d1 UTSW 10 80710836 unclassified probably benign
R1839:Ap3d1 UTSW 10 80727108 missense probably damaging 1.00
R1940:Ap3d1 UTSW 10 80709773 missense probably benign 0.03
R2081:Ap3d1 UTSW 10 80732936 missense probably damaging 1.00
R2258:Ap3d1 UTSW 10 80721132 missense probably benign 0.03
R2281:Ap3d1 UTSW 10 80713998 missense probably damaging 0.96
R2398:Ap3d1 UTSW 10 80719172 nonsense probably null
R2849:Ap3d1 UTSW 10 80741908 missense possibly damaging 0.65
R3856:Ap3d1 UTSW 10 80712185 missense probably benign
R4350:Ap3d1 UTSW 10 80719285 missense probably benign 0.15
R4590:Ap3d1 UTSW 10 80719812 nonsense probably null
R4782:Ap3d1 UTSW 10 80721586 splice site probably null
R4785:Ap3d1 UTSW 10 80712778 frame shift probably null
R4834:Ap3d1 UTSW 10 80719726 missense probably damaging 1.00
R4864:Ap3d1 UTSW 10 80712778 frame shift probably null
R5051:Ap3d1 UTSW 10 80719199 missense probably damaging 1.00
R5109:Ap3d1 UTSW 10 80709450 missense probably benign 0.11
R5219:Ap3d1 UTSW 10 80709817 missense probably benign 0.03
R5220:Ap3d1 UTSW 10 80727167 missense probably damaging 1.00
R5307:Ap3d1 UTSW 10 80723549 missense probably benign 0.29
R5586:Ap3d1 UTSW 10 80719130 missense possibly damaging 0.92
R5796:Ap3d1 UTSW 10 80714037 missense possibly damaging 0.70
R5905:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6025:Ap3d1 UTSW 10 80710464 missense probably benign 0.01
R6028:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6364:Ap3d1 UTSW 10 80710494 splice site probably null
R6469:Ap3d1 UTSW 10 80712158 missense probably benign
R6603:Ap3d1 UTSW 10 80714047 missense probably benign 0.04
R6872:Ap3d1 UTSW 10 80714322 nonsense probably null
R6887:Ap3d1 UTSW 10 80723698 missense probably damaging 1.00
R7249:Ap3d1 UTSW 10 80741933 missense probably damaging 1.00
R7316:Ap3d1 UTSW 10 80717859 missense probably damaging 1.00
R7325:Ap3d1 UTSW 10 80723803 missense probably damaging 1.00
R7395:Ap3d1 UTSW 10 80730882 missense probably benign 0.11
R7405:Ap3d1 UTSW 10 80741900 missense probably benign 0.16
R7425:Ap3d1 UTSW 10 80721592 missense probably damaging 1.00
R7558:Ap3d1 UTSW 10 80722921 missense possibly damaging 0.92
R7583:Ap3d1 UTSW 10 80709458 missense probably benign 0.13
R7703:Ap3d1 UTSW 10 80717844 missense probably damaging 1.00
R7964:Ap3d1 UTSW 10 80730057 missense probably damaging 1.00
R8021:Ap3d1 UTSW 10 80714301 missense probably benign 0.30
R8314:Ap3d1 UTSW 10 80723539 missense possibly damaging 0.91
R8356:Ap3d1 UTSW 10 80732903 missense probably damaging 1.00
X0019:Ap3d1 UTSW 10 80719102 missense probably damaging 1.00
X0026:Ap3d1 UTSW 10 80721147 missense possibly damaging 0.46
Z1088:Ap3d1 UTSW 10 80719237 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCACTCTGTAGAAGAAGGCTTG -3'
(R):5'- TCAGTGTTGACCTGCATCCC -3'

Sequencing Primer
(F):5'- GACACTAGCTGCCTCATTCAGG -3'
(R):5'- ATCCCCTGCCTGAGAGGAG -3'
Posted On2020-07-13