Incidental Mutation 'R8200:Sh3bp5l'
ID635636
Institutional Source Beutler Lab
Gene Symbol Sh3bp5l
Ensembl Gene ENSMUSG00000013646
Gene NameSH3 binding domain protein 5 like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R8200 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58330724-58347728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58331859 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 60 (I60T)
Ref Sequence ENSEMBL: ENSMUSP00000072872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065533] [ENSMUST00000073128] [ENSMUST00000116376] [ENSMUST00000186859]
Predicted Effect probably benign
Transcript: ENSMUST00000065533
Predicted Effect probably damaging
Transcript: ENSMUST00000073128
AA Change: I60T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000072872
Gene: ENSMUSG00000013646
AA Change: I60T

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
Pfam:SH3BP5 52 289 1.3e-103 PFAM
low complexity region 296 337 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000116376
AA Change: I60T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112077
Gene: ENSMUSG00000013646
AA Change: I60T

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
Pfam:SH3BP5 54 280 2.5e-97 PFAM
low complexity region 296 337 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186859
SMART Domains Protein: ENSMUSP00000140236
Gene: ENSMUSG00000049755

DomainStartEndE-ValueType
ZnF_C2H2 15 37 1.8e-5 SMART
ZnF_C2H2 43 65 3.6e-2 SMART
ZnF_C2H2 71 90 6.1e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.3%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930555G01Rik T A 14: 5,052,797 M132K probably benign Het
Abtb2 A G 2: 103,700,817 I431V probably benign Het
Ache A G 5: 137,294,195 Q601R probably damaging Het
Ap3d1 A T 10: 80,722,932 C279* probably null Het
Brms1l T C 12: 55,844,398 L79P probably damaging Het
Brpf3 C T 17: 28,806,274 A107V probably benign Het
Catsperd T C 17: 56,632,368 probably null Het
Ccnb1ip1 C T 14: 50,792,293 R104H probably benign Het
Ces1g T A 8: 93,328,457 N204I probably damaging Het
Cmbl T C 15: 31,585,393 V141A probably benign Het
Dmxl2 A T 9: 54,480,346 H69Q probably benign Het
Dnah10 T C 5: 124,828,460 L4113P probably damaging Het
Fam120a T C 13: 48,949,119 H220R probably damaging Het
Gm43218 C T 6: 70,240,544 G76E probably damaging Het
Gypa A T 8: 80,494,066 T5S unknown Het
Hyal6 A G 6: 24,734,566 D166G probably benign Het
Immt T A 6: 71,871,437 V470D probably damaging Het
Itpr1 A G 6: 108,394,865 S1167G probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Ndufs1 A T 1: 63,170,172 probably null Het
Nr1i3 C A 1: 171,217,697 H305N probably benign Het
Nucb2 T C 7: 116,533,163 probably null Het
Plau A C 14: 20,839,113 K130T possibly damaging Het
Ppef2 A T 5: 92,245,392 V246E probably benign Het
Prune2 G A 19: 17,124,973 V2499I probably benign Het
Rnf207 C T 4: 152,314,035 probably null Het
Sept9 A G 11: 117,232,716 T7A probably benign Het
Taar9 A G 10: 24,109,419 L39P probably damaging Het
Tcl1b5 A T 12: 105,178,953 M59L probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Thap2 A T 10: 115,376,487 F44L Het
Trp53bp1 A G 2: 121,236,176 S690P probably benign Het
Ttc9 T C 12: 81,660,661 Y165H probably damaging Het
Ttll11 A G 2: 35,944,928 I162T probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Tuft1 A T 3: 94,616,670 D292E probably damaging Het
Ubap2l T C 3: 90,023,626 S365G probably benign Het
Ugt2b37 G A 5: 87,240,891 Q488* probably null Het
Vmo1 A G 11: 70,514,499 V35A possibly damaging Het
Wdr36 A G 18: 32,865,926 K875R probably benign Het
Other mutations in Sh3bp5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Sh3bp5l APN 11 58346060 missense probably benign 0.01
IGL01503:Sh3bp5l APN 11 58338001 missense probably damaging 1.00
IGL01903:Sh3bp5l APN 11 58346038 missense probably damaging 0.96
IGL02556:Sh3bp5l APN 11 58346261 missense probably damaging 1.00
IGL02755:Sh3bp5l APN 11 58338003 missense probably benign
R0746:Sh3bp5l UTSW 11 58346347 missense probably benign 0.06
R1801:Sh3bp5l UTSW 11 58346351 missense probably benign
R4646:Sh3bp5l UTSW 11 58346351 missense probably benign
R5049:Sh3bp5l UTSW 11 58338124 intron probably benign
R5715:Sh3bp5l UTSW 11 58346015 missense possibly damaging 0.81
R6791:Sh3bp5l UTSW 11 58346272 missense probably damaging 0.99
R6882:Sh3bp5l UTSW 11 58331699 missense probably benign
R7251:Sh3bp5l UTSW 11 58341302 missense probably damaging 1.00
R7762:Sh3bp5l UTSW 11 58345928 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCCAGGAAGCCTCAAACTGG -3'
(R):5'- GCACTTGTCACACTTGTCACAC -3'

Sequencing Primer
(F):5'- AGCCCTCTCTTGTGCATAGGG -3'
(R):5'- ACACTGAACCGCCACGTTTTATG -3'
Posted On2020-07-13