Incidental Mutation 'R8200:Ttc9'
ID635640
Institutional Source Beutler Lab
Gene Symbol Ttc9
Ensembl Gene ENSMUSG00000042734
Gene Nametetratricopeptide repeat domain 9
Synonyms1700029M07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R8200 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location81631249-81667557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81660661 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 165 (Y165H)
Ref Sequence ENSEMBL: ENSMUSP00000048590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036116]
Predicted Effect probably damaging
Transcript: ENSMUST00000036116
AA Change: Y165H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048590
Gene: ENSMUSG00000042734
AA Change: Y165H

DomainStartEndE-ValueType
low complexity region 16 38 N/A INTRINSIC
TPR 56 89 7.69e1 SMART
TPR 125 160 7.89e1 SMART
TPR 161 194 6.05e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.3%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: This gene encodes a protein that contains three tetratricopeptide repeats. The human gene has been shown to be hormonally regulated in breast cancer cells and may play a role in cancer cell invasion and metastasis. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous KO adult females display increased body, thymus and spleen weights and improved mammary development and sensitivity to estrogen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930555G01Rik T A 14: 5,052,797 M132K probably benign Het
Abtb2 A G 2: 103,700,817 I431V probably benign Het
Ache A G 5: 137,294,195 Q601R probably damaging Het
Ap3d1 A T 10: 80,722,932 C279* probably null Het
Brms1l T C 12: 55,844,398 L79P probably damaging Het
Brpf3 C T 17: 28,806,274 A107V probably benign Het
Catsperd T C 17: 56,632,368 probably null Het
Ccnb1ip1 C T 14: 50,792,293 R104H probably benign Het
Ces1g T A 8: 93,328,457 N204I probably damaging Het
Cmbl T C 15: 31,585,393 V141A probably benign Het
Dmxl2 A T 9: 54,480,346 H69Q probably benign Het
Dnah10 T C 5: 124,828,460 L4113P probably damaging Het
Fam120a T C 13: 48,949,119 H220R probably damaging Het
Gm43218 C T 6: 70,240,544 G76E probably damaging Het
Gypa A T 8: 80,494,066 T5S unknown Het
Hyal6 A G 6: 24,734,566 D166G probably benign Het
Immt T A 6: 71,871,437 V470D probably damaging Het
Itpr1 A G 6: 108,394,865 S1167G probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Ndufs1 A T 1: 63,170,172 probably null Het
Nr1i3 C A 1: 171,217,697 H305N probably benign Het
Nucb2 T C 7: 116,533,163 probably null Het
Plau A C 14: 20,839,113 K130T possibly damaging Het
Ppef2 A T 5: 92,245,392 V246E probably benign Het
Prune2 G A 19: 17,124,973 V2499I probably benign Het
Rnf207 C T 4: 152,314,035 probably null Het
Sept9 A G 11: 117,232,716 T7A probably benign Het
Sh3bp5l T C 11: 58,331,859 I60T probably damaging Het
Taar9 A G 10: 24,109,419 L39P probably damaging Het
Tcl1b5 A T 12: 105,178,953 M59L probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Thap2 A T 10: 115,376,487 F44L Het
Trp53bp1 A G 2: 121,236,176 S690P probably benign Het
Ttll11 A G 2: 35,944,928 I162T probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Tuft1 A T 3: 94,616,670 D292E probably damaging Het
Ubap2l T C 3: 90,023,626 S365G probably benign Het
Ugt2b37 G A 5: 87,240,891 Q488* probably null Het
Vmo1 A G 11: 70,514,499 V35A possibly damaging Het
Wdr36 A G 18: 32,865,926 K875R probably benign Het
Other mutations in Ttc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Ttc9 APN 12 81631762 missense possibly damaging 0.47
IGL02366:Ttc9 APN 12 81631610 missense possibly damaging 0.92
R0494:Ttc9 UTSW 12 81631649 missense probably damaging 1.00
R1892:Ttc9 UTSW 12 81631777 missense probably benign
R2069:Ttc9 UTSW 12 81631796 missense probably damaging 1.00
R4679:Ttc9 UTSW 12 81631601 missense probably damaging 0.99
R5828:Ttc9 UTSW 12 81631676 missense probably benign 0.01
R5876:Ttc9 UTSW 12 81631622 missense probably damaging 1.00
R8675:Ttc9 UTSW 12 81660605 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTACAGAGATGGGCTGGG -3'
(R):5'- ACAGACACCATCTTCTGCGATG -3'

Sequencing Primer
(F):5'- TGAACTCGTAGCTATCCTGGGAC -3'
(R):5'- TGAGCAGGCCCTAGGAACTG -3'
Posted On2020-07-13