Incidental Mutation 'R8200:Ttll5'
ID635642
Institutional Source Beutler Lab
Gene Symbol Ttll5
Ensembl Gene ENSMUSG00000012609
Gene Nametubulin tyrosine ligase-like family, member 5
SynonymsSTAMP
MMRRC Submission
Accession Numbers

Genbank: NM_001081423

Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R8200 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location85824659-86061893 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85879410 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 326 (I326N)
Ref Sequence ENSEMBL: ENSMUSP00000039939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040179] [ENSMUST00000040273] [ENSMUST00000095536] [ENSMUST00000110220] [ENSMUST00000110224] [ENSMUST00000155448] [ENSMUST00000176695] [ENSMUST00000177114]
Predicted Effect probably damaging
Transcript: ENSMUST00000040179
AA Change: I326N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048809
Gene: ENSMUSG00000012609
AA Change: I326N

DomainStartEndE-ValueType
Pfam:TTL 110 407 1.9e-94 PFAM
low complexity region 556 575 N/A INTRINSIC
low complexity region 595 621 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 1167 1181 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000040273
AA Change: I326N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039939
Gene: ENSMUSG00000012609
AA Change: I326N

DomainStartEndE-ValueType
Pfam:TTL 110 407 1e-94 PFAM
low complexity region 556 575 N/A INTRINSIC
low complexity region 595 621 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 1167 1181 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095536
AA Change: I326N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093192
Gene: ENSMUSG00000012609
AA Change: I326N

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.2e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110220
AA Change: I326N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105849
Gene: ENSMUSG00000012609
AA Change: I326N

DomainStartEndE-ValueType
Pfam:TTL 110 348 3.5e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110224
AA Change: I326N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105853
Gene: ENSMUSG00000012609
AA Change: I326N

DomainStartEndE-ValueType
Pfam:TTL 110 407 1e-94 PFAM
low complexity region 543 562 N/A INTRINSIC
low complexity region 582 608 N/A INTRINSIC
low complexity region 734 748 N/A INTRINSIC
low complexity region 768 780 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 1153 1167 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155448
AA Change: I326N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134971
Gene: ENSMUSG00000012609
AA Change: I326N

DomainStartEndE-ValueType
Pfam:TTL 110 407 6.4e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175899
Predicted Effect probably damaging
Transcript: ENSMUST00000176695
AA Change: I326N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135852
Gene: ENSMUSG00000012609
AA Change: I326N

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.1e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177114
AA Change: I326N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135395
Gene: ENSMUSG00000012609
AA Change: I326N

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.1e-95 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.3%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubulin tyrosine ligase like protein family. This protein interacts with two glucocorticoid receptor coactivators, transcriptional intermediary factor 2 and steroid receptor coactivator 1. This protein may function as a coregulator of glucocorticoid receptor mediated gene induction and repression. This protein may also function as an alpha tubulin polyglutamylase.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit male infertility associated with abnormal sperm morphology and reduced tubulin polyglutamylation in the spermatozoa. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(3) Gene trapped(4)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930555G01Rik T A 14: 5,052,797 M132K probably benign Het
Abtb2 A G 2: 103,700,817 I431V probably benign Het
Ache A G 5: 137,294,195 Q601R probably damaging Het
Ap3d1 A T 10: 80,722,932 C279* probably null Het
Brms1l T C 12: 55,844,398 L79P probably damaging Het
Brpf3 C T 17: 28,806,274 A107V probably benign Het
Catsperd T C 17: 56,632,368 probably null Het
Ccnb1ip1 C T 14: 50,792,293 R104H probably benign Het
Ces1g T A 8: 93,328,457 N204I probably damaging Het
Cmbl T C 15: 31,585,393 V141A probably benign Het
Dmxl2 A T 9: 54,480,346 H69Q probably benign Het
Dnah10 T C 5: 124,828,460 L4113P probably damaging Het
Fam120a T C 13: 48,949,119 H220R probably damaging Het
Gm43218 C T 6: 70,240,544 G76E probably damaging Het
Gypa A T 8: 80,494,066 T5S unknown Het
Hyal6 A G 6: 24,734,566 D166G probably benign Het
Immt T A 6: 71,871,437 V470D probably damaging Het
Itpr1 A G 6: 108,394,865 S1167G probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Ndufs1 A T 1: 63,170,172 probably null Het
Nr1i3 C A 1: 171,217,697 H305N probably benign Het
Nucb2 T C 7: 116,533,163 probably null Het
Plau A C 14: 20,839,113 K130T possibly damaging Het
Ppef2 A T 5: 92,245,392 V246E probably benign Het
Prune2 G A 19: 17,124,973 V2499I probably benign Het
Rnf207 C T 4: 152,314,035 probably null Het
Sept9 A G 11: 117,232,716 T7A probably benign Het
Sh3bp5l T C 11: 58,331,859 I60T probably damaging Het
Taar9 A G 10: 24,109,419 L39P probably damaging Het
Tcl1b5 A T 12: 105,178,953 M59L probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Thap2 A T 10: 115,376,487 F44L Het
Trp53bp1 A G 2: 121,236,176 S690P probably benign Het
Ttc9 T C 12: 81,660,661 Y165H probably damaging Het
Ttll11 A G 2: 35,944,928 I162T probably damaging Het
Tuft1 A T 3: 94,616,670 D292E probably damaging Het
Ubap2l T C 3: 90,023,626 S365G probably benign Het
Ugt2b37 G A 5: 87,240,891 Q488* probably null Het
Vmo1 A G 11: 70,514,499 V35A possibly damaging Het
Wdr36 A G 18: 32,865,926 K875R probably benign Het
Other mutations in Ttll5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Ttll5 APN 12 85843826 missense probably damaging 1.00
IGL00932:Ttll5 APN 12 85929907 missense probably damaging 1.00
IGL00964:Ttll5 APN 12 85849283 missense possibly damaging 0.78
IGL00978:Ttll5 APN 12 85933482 nonsense probably null
IGL00990:Ttll5 APN 12 85876589 missense probably damaging 1.00
IGL01726:Ttll5 APN 12 85918934 missense probably benign 0.30
IGL01797:Ttll5 APN 12 85956597 missense possibly damaging 0.54
IGL02008:Ttll5 APN 12 85933611 missense probably damaging 1.00
IGL02210:Ttll5 APN 12 85912545 intron probably benign
IGL02979:Ttll5 APN 12 85826582 missense probably damaging 1.00
IGL03079:Ttll5 APN 12 85876558 missense probably damaging 1.00
IGL03149:Ttll5 APN 12 85918984 missense probably damaging 0.98
G4846:Ttll5 UTSW 12 86024244 missense probably damaging 0.99
PIT4812001:Ttll5 UTSW 12 85926861 missense probably benign 0.12
R0045:Ttll5 UTSW 12 85879359 splice site probably benign
R0153:Ttll5 UTSW 12 85831966 missense probably damaging 1.00
R0282:Ttll5 UTSW 12 85996053 missense probably benign 0.12
R0318:Ttll5 UTSW 12 85876594 critical splice donor site probably null
R0465:Ttll5 UTSW 12 85933326 missense probably benign 0.42
R0540:Ttll5 UTSW 12 85933676 critical splice donor site probably null
R1086:Ttll5 UTSW 12 85891079 missense possibly damaging 0.66
R1467:Ttll5 UTSW 12 85918962 splice site probably null
R1470:Ttll5 UTSW 12 85879394 missense possibly damaging 0.59
R1470:Ttll5 UTSW 12 85879394 missense possibly damaging 0.59
R1505:Ttll5 UTSW 12 85879410 missense probably damaging 1.00
R1524:Ttll5 UTSW 12 85864568 nonsense probably null
R1540:Ttll5 UTSW 12 85892208 nonsense probably null
R1598:Ttll5 UTSW 12 85863598 missense probably damaging 0.98
R1649:Ttll5 UTSW 12 85923014 missense probably damaging 1.00
R1774:Ttll5 UTSW 12 85933402 missense probably benign 0.09
R2340:Ttll5 UTSW 12 85892148 missense probably benign 0.02
R4049:Ttll5 UTSW 12 86012799 missense probably benign 0.01
R4094:Ttll5 UTSW 12 85956602 nonsense probably null
R4095:Ttll5 UTSW 12 85956602 nonsense probably null
R4908:Ttll5 UTSW 12 85919174 missense probably benign 0.31
R5012:Ttll5 UTSW 12 85926844 missense possibly damaging 0.93
R5137:Ttll5 UTSW 12 85923045 missense possibly damaging 0.83
R5416:Ttll5 UTSW 12 86012828 missense possibly damaging 0.77
R5773:Ttll5 UTSW 12 85933555 frame shift probably null
R5774:Ttll5 UTSW 12 85933555 frame shift probably null
R6039:Ttll5 UTSW 12 85831955 missense probably damaging 1.00
R6039:Ttll5 UTSW 12 85831955 missense probably damaging 1.00
R6173:Ttll5 UTSW 12 85933377 missense probably damaging 0.99
R6343:Ttll5 UTSW 12 85956699 missense probably benign 0.00
R6449:Ttll5 UTSW 12 86024276 missense probably benign 0.00
R6750:Ttll5 UTSW 12 85956610 missense probably damaging 0.98
R6802:Ttll5 UTSW 12 85879386 missense probably damaging 1.00
R6825:Ttll5 UTSW 12 85883328 splice site probably null
R6955:Ttll5 UTSW 12 85864579 missense possibly damaging 0.91
R7098:Ttll5 UTSW 12 85917673 critical splice acceptor site probably null
R7154:Ttll5 UTSW 12 85925764 missense probably damaging 0.98
R7215:Ttll5 UTSW 12 85933396 missense probably benign 0.02
R7339:Ttll5 UTSW 12 85857464 critical splice donor site probably null
R7520:Ttll5 UTSW 12 85899471 missense probably damaging 1.00
R7728:Ttll5 UTSW 12 85956632 missense probably benign 0.02
R7894:Ttll5 UTSW 12 85889174 missense probably damaging 1.00
R8119:Ttll5 UTSW 12 86020548 missense probably damaging 0.98
R8129:Ttll5 UTSW 12 85891084 critical splice donor site probably null
R8357:Ttll5 UTSW 12 85876578 missense probably damaging 1.00
R8413:Ttll5 UTSW 12 85919121 missense probably benign 0.00
R8457:Ttll5 UTSW 12 85876578 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTCTGTACCTTCTGCAC -3'
(R):5'- AAACCCAGGATGTGCCCTTG -3'

Sequencing Primer
(F):5'- TGTAGCACCCGGACTGAAGAC -3'
(R):5'- TGCCTCCTGGAGAAATCACTATG -3'
Posted On2020-07-13