Incidental Mutation 'R8201:Sel1l2'
ID635658
Institutional Source Beutler Lab
Gene Symbol Sel1l2
Ensembl Gene ENSMUSG00000074764
Gene Namesel-1 suppressor of lin-12-like 2 (C. elegans)
SynonymsLOC228684
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.551) question?
Stock #R8201 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location140229855-140389706 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 140266392 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 191 (Y191D)
Ref Sequence ENSEMBL: ENSMUSP00000113800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122367]
Predicted Effect probably damaging
Transcript: ENSMUST00000122367
AA Change: Y191D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113800
Gene: ENSMUSG00000074764
AA Change: Y191D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 70 83 N/A INTRINSIC
SEL1 107 142 1.99e2 SMART
SEL1 143 178 3.3e1 SMART
SEL1 179 214 5.7e-1 SMART
SEL1 215 250 6.3e-3 SMART
SEL1 297 333 6.59e-6 SMART
SEL1 334 370 1.32e-5 SMART
SEL1 371 406 4.55e-9 SMART
SEL1 407 442 4.02e-10 SMART
SEL1 443 478 2.72e-7 SMART
Blast:SEL1 511 550 9e-13 BLAST
SEL1 551 586 1.01e-6 SMART
SEL1 588 623 4.55e-9 SMART
transmembrane domain 661 683 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in Sel1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Sel1l2 APN 2 140243944 missense possibly damaging 0.95
IGL01782:Sel1l2 APN 2 140243935 missense probably damaging 1.00
IGL02238:Sel1l2 APN 2 140247939 missense probably damaging 1.00
IGL02506:Sel1l2 APN 2 140275460 missense possibly damaging 0.89
IGL02539:Sel1l2 APN 2 140230858 missense probably damaging 1.00
IGL02999:Sel1l2 APN 2 140230804 missense probably damaging 1.00
IGL03388:Sel1l2 APN 2 140263364 splice site probably benign
IGL02988:Sel1l2 UTSW 2 140248588 missense probably damaging 1.00
R0386:Sel1l2 UTSW 2 140275441 missense probably benign 0.11
R0426:Sel1l2 UTSW 2 140240912 nonsense probably null
R0549:Sel1l2 UTSW 2 140265882 missense probably damaging 0.99
R1404:Sel1l2 UTSW 2 140230059 splice site probably benign
R1502:Sel1l2 UTSW 2 140389595 missense probably damaging 0.99
R1746:Sel1l2 UTSW 2 140285237 missense probably damaging 0.98
R2187:Sel1l2 UTSW 2 140230873 missense probably damaging 1.00
R2233:Sel1l2 UTSW 2 140244165 missense probably damaging 1.00
R2235:Sel1l2 UTSW 2 140244165 missense probably damaging 1.00
R3402:Sel1l2 UTSW 2 140241038 missense probably damaging 1.00
R4717:Sel1l2 UTSW 2 140230023 missense possibly damaging 0.89
R4724:Sel1l2 UTSW 2 140240927 missense probably damaging 0.99
R4840:Sel1l2 UTSW 2 140263470 missense probably benign 0.00
R4948:Sel1l2 UTSW 2 140244166 missense probably damaging 1.00
R6008:Sel1l2 UTSW 2 140244105 missense probably damaging 1.00
R6058:Sel1l2 UTSW 2 140240969 missense possibly damaging 0.94
R6389:Sel1l2 UTSW 2 140245354 missense probably damaging 1.00
R7031:Sel1l2 UTSW 2 140340123 missense possibly damaging 0.84
R7056:Sel1l2 UTSW 2 140245414 missense probably benign 0.13
R7074:Sel1l2 UTSW 2 140263442 missense probably damaging 1.00
R7213:Sel1l2 UTSW 2 140244135 missense probably damaging 1.00
R7348:Sel1l2 UTSW 2 140265724 missense probably benign
R8030:Sel1l2 UTSW 2 140241018 missense probably damaging 0.97
R8100:Sel1l2 UTSW 2 140275409 missense probably damaging 1.00
R8165:Sel1l2 UTSW 2 140262706 missense probably damaging 1.00
R8343:Sel1l2 UTSW 2 140230833 missense probably benign 0.03
X0019:Sel1l2 UTSW 2 140248615 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCAGTTTGTGGCAGATTG -3'
(R):5'- TTCACAGACATCATGTAATCCTCCC -3'

Sequencing Primer
(F):5'- CAGTTTGTGGCAGATTGTTAAATTTC -3'
(R):5'- GTTCTTGCAAAAGACCAGGATTCG -3'
Posted On2020-07-13