Incidental Mutation 'R8201:Noct'
ID635659
Institutional Source Beutler Lab
Gene Symbol Noct
Ensembl Gene ENSMUSG00000023087
Gene Namenocturnin
SynonymsCcrn4l, Ccr4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R8201 (G1)
Quality Score198.009
Status Not validated
Chromosome3
Chromosomal Location51224447-51251644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51248023 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 135 (S135P)
Ref Sequence ENSEMBL: ENSMUSP00000023849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023849] [ENSMUST00000144826] [ENSMUST00000167780] [ENSMUST00000193018] [ENSMUST00000194641]
Predicted Effect probably benign
Transcript: ENSMUST00000023849
AA Change: S135P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023849
Gene: ENSMUSG00000023087
AA Change: S135P

DomainStartEndE-ValueType
low complexity region 48 58 N/A INTRINSIC
Pfam:Exo_endo_phos 144 412 3.6e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144826
AA Change: S71P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141416
Gene: ENSMUSG00000023087
AA Change: S71P

DomainStartEndE-ValueType
Pfam:Exo_endo_phos 80 348 6.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167780
AA Change: S135P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130347
Gene: ENSMUSG00000023087
AA Change: S135P

DomainStartEndE-ValueType
low complexity region 48 58 N/A INTRINSIC
Pfam:Exo_endo_phos 144 412 5.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193018
AA Change: S71P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142216
Gene: ENSMUSG00000023087
AA Change: S71P

DomainStartEndE-ValueType
SCOP:d1hd7a_ 52 84 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194641
SMART Domains Protein: ENSMUSP00000141197
Gene: ENSMUSG00000037174

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 108 1.2e-37 PFAM
low complexity region 142 154 N/A INTRINSIC
low complexity region 172 181 N/A INTRINSIC
ETS 207 294 1.28e-51 SMART
low complexity region 369 391 N/A INTRINSIC
low complexity region 423 433 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to Nocturnin, a gene identified as a circadian clock regulated gene in Xenopus laevis. This protein and Nocturnin protein share similarity with the C-terminal domain of a yeast transcription factor, carbon catabolite repression 4 (CCR4). The mRNA abundance of a similar gene in mouse has been shown to exhibit circadian rhythmicity, which suggests a role for this protein in clock function or as a circadian clock effector. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are resistant to diet-induced obesity and fatty liver development, show increased circulating glucose levels and increased insulin sensitivity on a standard diet and have impaired glucose tolerance on a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in Noct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Noct APN 3 51248048 missense probably damaging 0.99
R0256:Noct UTSW 3 51250474 missense probably damaging 1.00
R1399:Noct UTSW 3 51250476 splice site probably null
R1539:Noct UTSW 3 51247912 nonsense probably null
R1618:Noct UTSW 3 51247830 missense probably damaging 1.00
R2001:Noct UTSW 3 51248044 missense probably damaging 1.00
R2176:Noct UTSW 3 51249696 critical splice acceptor site probably null
R2408:Noct UTSW 3 51225289 critical splice donor site probably null
R4413:Noct UTSW 3 51250335 missense probably damaging 1.00
R4552:Noct UTSW 3 51250168 missense probably benign 0.16
R4690:Noct UTSW 3 51247879 nonsense probably null
R4993:Noct UTSW 3 51250021 missense probably damaging 1.00
R5009:Noct UTSW 3 51248061 missense probably damaging 1.00
R6467:Noct UTSW 3 51250087 missense possibly damaging 0.90
R6631:Noct UTSW 3 51250200 missense probably damaging 1.00
R7454:Noct UTSW 3 51249730 missense probably damaging 1.00
R7467:Noct UTSW 3 51225201 missense probably benign 0.01
R7911:Noct UTSW 3 51247648 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCTACAGTGCTCTCGCCAAG -3'
(R):5'- TGTCACAGACTCAGGCTGTAGG -3'

Sequencing Primer
(F):5'- GACCGTCAACAGCAGTGCAG -3'
(R):5'- CAACAGAATGCCTAAGGTTGTCCTG -3'
Posted On2020-07-13