Incidental Mutation 'R8201:Fam189b'
ID635660
Institutional Source Beutler Lab
Gene Symbol Fam189b
Ensembl Gene ENSMUSG00000032657
Gene Namefamily with sequence similarity 189, member B
Synonyms1110013L07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R8201 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location89183143-89189295 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89185808 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 291 (V291A)
Ref Sequence ENSEMBL: ENSMUSP00000039261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029684] [ENSMUST00000041913] [ENSMUST00000098941] [ENSMUST00000117278] [ENSMUST00000119707] [ENSMUST00000120697] [ENSMUST00000127982] [ENSMUST00000140473] [ENSMUST00000147696]
Predicted Effect probably benign
Transcript: ENSMUST00000029684
SMART Domains Protein: ENSMUSP00000029684
Gene: ENSMUSG00000028049

DomainStartEndE-ValueType
low complexity region 49 69 N/A INTRINSIC
coiled coil region 89 127 N/A INTRINSIC
Pfam:SCAMP 133 310 1.5e-76 PFAM
low complexity region 329 348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000041913
AA Change: V291A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039261
Gene: ENSMUSG00000032657
AA Change: V291A

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 196 8e-36 PFAM
low complexity region 243 254 N/A INTRINSIC
low complexity region 390 408 N/A INTRINSIC
low complexity region 445 463 N/A INTRINSIC
low complexity region 471 490 N/A INTRINSIC
low complexity region 628 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098941
SMART Domains Protein: ENSMUSP00000096540
Gene: ENSMUSG00000028049

DomainStartEndE-ValueType
low complexity region 49 69 N/A INTRINSIC
coiled coil region 89 127 N/A INTRINSIC
Pfam:SCAMP 133 229 5.5e-46 PFAM
Pfam:SCAMP 227 276 2.2e-11 PFAM
low complexity region 295 314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117278
AA Change: V272A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113706
Gene: ENSMUSG00000032657
AA Change: V272A

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
Pfam:CD20 74 177 7.3e-13 PFAM
low complexity region 224 235 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
low complexity region 426 444 N/A INTRINSIC
low complexity region 452 471 N/A INTRINSIC
low complexity region 609 630 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119707
AA Change: V213A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113579
Gene: ENSMUSG00000032657
AA Change: V213A

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 196 1.9e-18 PFAM
low complexity region 312 330 N/A INTRINSIC
low complexity region 367 385 N/A INTRINSIC
low complexity region 393 412 N/A INTRINSIC
low complexity region 550 571 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120697
SMART Domains Protein: ENSMUSP00000112846
Gene: ENSMUSG00000028049

DomainStartEndE-ValueType
low complexity region 50 70 N/A INTRINSIC
coiled coil region 90 128 N/A INTRINSIC
Pfam:SCAMP 135 310 1.1e-67 PFAM
low complexity region 330 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127982
SMART Domains Protein: ENSMUSP00000114855
Gene: ENSMUSG00000032657

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 77 6.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140473
Predicted Effect probably benign
Transcript: ENSMUST00000147696
SMART Domains Protein: ENSMUSP00000117185
Gene: ENSMUSG00000032657

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 196 1.9e-30 PFAM
low complexity region 242 253 N/A INTRINSIC
low complexity region 324 349 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located near the gene for the lysosomal enzyme glucosylceramidase; a deficiency in this enzyme is associated with Gaucher disease. The encoded protein has been identified as a potential binding partner of a WW domain-containing protein which is involved in apoptosis and tumor suppression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in Fam189b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Fam189b APN 3 89188426 missense probably damaging 1.00
IGL01554:Fam189b APN 3 89185581 missense probably damaging 1.00
IGL02061:Fam189b APN 3 89188596 nonsense probably null
IGL02064:Fam189b APN 3 89188596 nonsense probably null
IGL02065:Fam189b APN 3 89188596 nonsense probably null
IGL02066:Fam189b APN 3 89188596 nonsense probably null
IGL02067:Fam189b APN 3 89188596 nonsense probably null
IGL02068:Fam189b APN 3 89188596 nonsense probably null
IGL02890:Fam189b APN 3 89186782 missense possibly damaging 0.66
R1219:Fam189b UTSW 3 89183848 missense probably damaging 0.99
R1634:Fam189b UTSW 3 89188094 missense probably damaging 1.00
R1645:Fam189b UTSW 3 89186847 missense possibly damaging 0.65
R2043:Fam189b UTSW 3 89185567 missense probably damaging 1.00
R4176:Fam189b UTSW 3 89184447 missense probably damaging 1.00
R4379:Fam189b UTSW 3 89185757 missense probably damaging 1.00
R5972:Fam189b UTSW 3 89185808 missense probably damaging 1.00
R7617:Fam189b UTSW 3 89184971 missense probably damaging 1.00
R7831:Fam189b UTSW 3 89184213 splice site probably null
R7867:Fam189b UTSW 3 89185776 nonsense probably null
R8099:Fam189b UTSW 3 89183943 missense probably damaging 1.00
R8314:Fam189b UTSW 3 89188146 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCACAAAGGTAAGGCTGGA -3'
(R):5'- GGGGCATCAGTTTCCATATCTTT -3'

Sequencing Primer
(F):5'- CAAAGGTAAGGCTGGAGGTGG -3'
(R):5'- GTCAGATCTCATTACAGGTGAGCC -3'
Posted On2020-07-13