Incidental Mutation 'R8201:1700006A11Rik'
ID 635662
Institutional Source Beutler Lab
Gene Symbol 1700006A11Rik
Ensembl Gene ENSMUSG00000027973
Gene Name RIKEN cDNA 1700006A11 gene
Synonyms
MMRRC Submission 067624-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R8201 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 124194639-124219688 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 124195046 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 543 (E543G)
Ref Sequence ENSEMBL: ENSMUSP00000029598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029598] [ENSMUST00000198630]
AlphaFold B9EHI3
Predicted Effect probably benign
Transcript: ENSMUST00000029598
AA Change: E543G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029598
Gene: ENSMUSG00000027973
AA Change: E543G

DomainStartEndE-ValueType
RhoGAP 78 251 3.63e-37 SMART
RhoGAP 377 543 3.19e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,341,278 (GRCm39) N302K possibly damaging Het
Apbb2 T C 5: 66,466,458 (GRCm39) N609S probably benign Het
Atp10a G T 7: 58,469,424 (GRCm39) G1092* probably null Het
Ccdc150 A G 1: 54,368,646 (GRCm39) N618S probably benign Het
Cct4 T A 11: 22,949,115 (GRCm39) V287E probably damaging Het
Cyp2j7 A T 4: 96,083,564 (GRCm39) I462N probably damaging Het
Dnajc6 C T 4: 101,475,960 (GRCm39) A611V probably benign Het
Dusp10 C A 1: 183,769,202 (GRCm39) A56E possibly damaging Het
Entrep3 T C 3: 89,093,115 (GRCm39) V291A probably damaging Het
Fat3 A C 9: 15,908,773 (GRCm39) C2410G possibly damaging Het
Fcgrt T A 7: 44,744,634 (GRCm39) Q274L possibly damaging Het
Fdxacb1 G T 9: 50,681,455 (GRCm39) probably benign Het
Fubp1 T A 3: 151,927,823 (GRCm39) I424N probably damaging Het
Gm5114 T A 7: 39,060,373 (GRCm39) T159S probably damaging Het
Gm7168 T C 17: 14,170,042 (GRCm39) C470R probably benign Het
Hebp1 A G 6: 135,114,906 (GRCm39) V185A possibly damaging Het
Il18rap G T 1: 40,578,429 (GRCm39) R280I possibly damaging Het
Mamdc4 T C 2: 25,456,093 (GRCm39) N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 (GRCm39) N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 (GRCm38) probably benign Het
Noct T C 3: 51,155,444 (GRCm39) S135P probably benign Het
Or1e23 T A 11: 73,407,899 (GRCm39) N42I probably damaging Het
Or2t48 A T 11: 58,419,865 (GRCm39) *316R noncoding transcript Het
Or2w3b A C 11: 58,623,940 (GRCm39) F17C probably damaging Het
Or7e177 G T 9: 20,212,317 (GRCm39) G271C probably damaging Het
Or7e178 T C 9: 20,225,908 (GRCm39) M103V probably benign Het
Pcdhac1 A T 18: 37,223,892 (GRCm39) H235L probably benign Het
Pcdhb22 G T 18: 37,651,518 (GRCm39) probably benign Het
Pdlim1 A T 19: 40,218,958 (GRCm39) D224E probably benign Het
Plpp3 G T 4: 105,076,555 (GRCm39) G223W probably damaging Het
Rcan3 A G 4: 135,147,684 (GRCm39) F81S probably damaging Het
Sel1l2 A C 2: 140,108,312 (GRCm39) Y191D probably damaging Het
Supt16 A G 14: 52,408,447 (GRCm39) F833L probably damaging Het
Tchh T C 3: 93,350,781 (GRCm39) F74L probably damaging Het
Tgfbr3 T C 5: 107,278,431 (GRCm39) D725G probably benign Het
Tmem14c C T 13: 41,171,186 (GRCm39) P10S probably benign Het
Ubb G A 11: 62,443,053 (GRCm39) A28T probably benign Het
Vars2 A T 17: 35,969,202 (GRCm39) V833E probably benign Het
Zfyve9 T C 4: 108,507,474 (GRCm39) D528G possibly damaging Het
Other mutations in 1700006A11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:1700006A11Rik APN 3 124,195,058 (GRCm39) missense probably benign 0.30
IGL02552:1700006A11Rik APN 3 124,208,145 (GRCm39) missense probably damaging 1.00
IGL03092:1700006A11Rik APN 3 124,200,119 (GRCm39) missense probably damaging 1.00
R0094:1700006A11Rik UTSW 3 124,203,427 (GRCm39) splice site probably benign
R0097:1700006A11Rik UTSW 3 124,206,129 (GRCm39) missense probably benign 0.13
R0097:1700006A11Rik UTSW 3 124,206,129 (GRCm39) missense probably benign 0.13
R0184:1700006A11Rik UTSW 3 124,212,899 (GRCm39) missense probably damaging 1.00
R0361:1700006A11Rik UTSW 3 124,207,283 (GRCm39) missense possibly damaging 0.69
R1542:1700006A11Rik UTSW 3 124,208,055 (GRCm39) missense possibly damaging 0.95
R1549:1700006A11Rik UTSW 3 124,210,441 (GRCm39) missense probably benign 0.00
R1779:1700006A11Rik UTSW 3 124,200,163 (GRCm39) missense probably damaging 0.99
R1839:1700006A11Rik UTSW 3 124,203,369 (GRCm39) missense probably damaging 0.99
R1986:1700006A11Rik UTSW 3 124,212,977 (GRCm39) missense probably damaging 0.99
R2042:1700006A11Rik UTSW 3 124,210,377 (GRCm39) splice site probably benign
R2149:1700006A11Rik UTSW 3 124,203,335 (GRCm39) missense probably benign 0.33
R2258:1700006A11Rik UTSW 3 124,207,267 (GRCm39) missense possibly damaging 0.84
R2291:1700006A11Rik UTSW 3 124,207,450 (GRCm39) missense probably damaging 1.00
R2509:1700006A11Rik UTSW 3 124,200,102 (GRCm39) missense probably benign 0.44
R4912:1700006A11Rik UTSW 3 124,213,505 (GRCm39) missense possibly damaging 0.68
R5074:1700006A11Rik UTSW 3 124,210,482 (GRCm39) missense probably benign 0.01
R5303:1700006A11Rik UTSW 3 124,199,999 (GRCm39) missense probably damaging 1.00
R5307:1700006A11Rik UTSW 3 124,199,999 (GRCm39) missense probably damaging 1.00
R5308:1700006A11Rik UTSW 3 124,199,999 (GRCm39) missense probably damaging 1.00
R5796:1700006A11Rik UTSW 3 124,215,077 (GRCm39) missense possibly damaging 0.66
R6018:1700006A11Rik UTSW 3 124,210,448 (GRCm39) missense probably damaging 1.00
R6198:1700006A11Rik UTSW 3 124,210,499 (GRCm39) splice site probably null
R6504:1700006A11Rik UTSW 3 124,213,569 (GRCm39) missense probably benign
R7124:1700006A11Rik UTSW 3 124,208,042 (GRCm39) missense probably benign 0.04
R7248:1700006A11Rik UTSW 3 124,207,959 (GRCm39) critical splice donor site probably null
R7351:1700006A11Rik UTSW 3 124,206,159 (GRCm39) missense probably damaging 1.00
R7709:1700006A11Rik UTSW 3 124,201,334 (GRCm39) missense probably damaging 1.00
R7773:1700006A11Rik UTSW 3 124,206,180 (GRCm39) missense probably benign 0.00
R8193:1700006A11Rik UTSW 3 124,213,517 (GRCm39) missense possibly damaging 0.84
R9157:1700006A11Rik UTSW 3 124,207,220 (GRCm39) missense probably benign 0.22
R9313:1700006A11Rik UTSW 3 124,207,220 (GRCm39) missense probably benign 0.22
R9585:1700006A11Rik UTSW 3 124,199,993 (GRCm39) missense possibly damaging 0.73
R9683:1700006A11Rik UTSW 3 124,200,095 (GRCm39) missense probably benign 0.01
R9721:1700006A11Rik UTSW 3 124,212,932 (GRCm39) missense probably benign 0.00
X0063:1700006A11Rik UTSW 3 124,213,511 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGATTCTCATTTCTGGACAGAAGC -3'
(R):5'- CACTGTGCAGAGTGTGGATG -3'

Sequencing Primer
(F):5'- TTTCTGGACAGAAGCAAAAATCC -3'
(R):5'- CACTGTGCAGAGTGTGGATGATATTC -3'
Posted On 2020-07-13