Incidental Mutation 'R8201:1700006A11Rik'
ID635662
Institutional Source Beutler Lab
Gene Symbol 1700006A11Rik
Ensembl Gene ENSMUSG00000027973
Gene NameRIKEN cDNA 1700006A11 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R8201 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location124400989-124426040 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124401397 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 543 (E543G)
Ref Sequence ENSEMBL: ENSMUSP00000029598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029598] [ENSMUST00000198630]
Predicted Effect probably benign
Transcript: ENSMUST00000029598
AA Change: E543G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029598
Gene: ENSMUSG00000027973
AA Change: E543G

DomainStartEndE-ValueType
RhoGAP 78 251 3.63e-37 SMART
RhoGAP 377 543 3.19e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in 1700006A11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:1700006A11Rik APN 3 124401409 missense probably benign 0.30
IGL02552:1700006A11Rik APN 3 124414496 missense probably damaging 1.00
IGL03092:1700006A11Rik APN 3 124406470 missense probably damaging 1.00
R0094:1700006A11Rik UTSW 3 124409778 splice site probably benign
R0097:1700006A11Rik UTSW 3 124412480 missense probably benign 0.13
R0097:1700006A11Rik UTSW 3 124412480 missense probably benign 0.13
R0184:1700006A11Rik UTSW 3 124419250 missense probably damaging 1.00
R0361:1700006A11Rik UTSW 3 124413634 missense possibly damaging 0.69
R1542:1700006A11Rik UTSW 3 124414406 missense possibly damaging 0.95
R1549:1700006A11Rik UTSW 3 124416792 missense probably benign 0.00
R1779:1700006A11Rik UTSW 3 124406514 missense probably damaging 0.99
R1839:1700006A11Rik UTSW 3 124409720 missense probably damaging 0.99
R1986:1700006A11Rik UTSW 3 124419328 missense probably damaging 0.99
R2042:1700006A11Rik UTSW 3 124416728 splice site probably benign
R2149:1700006A11Rik UTSW 3 124409686 missense probably benign 0.33
R2258:1700006A11Rik UTSW 3 124413618 missense possibly damaging 0.84
R2291:1700006A11Rik UTSW 3 124413801 missense probably damaging 1.00
R2509:1700006A11Rik UTSW 3 124406453 missense probably benign 0.44
R4912:1700006A11Rik UTSW 3 124419856 missense possibly damaging 0.68
R5074:1700006A11Rik UTSW 3 124416833 missense probably benign 0.01
R5303:1700006A11Rik UTSW 3 124406350 missense probably damaging 1.00
R5307:1700006A11Rik UTSW 3 124406350 missense probably damaging 1.00
R5308:1700006A11Rik UTSW 3 124406350 missense probably damaging 1.00
R5796:1700006A11Rik UTSW 3 124421428 missense possibly damaging 0.66
R6018:1700006A11Rik UTSW 3 124416799 missense probably damaging 1.00
R6198:1700006A11Rik UTSW 3 124416850 splice site probably null
R6504:1700006A11Rik UTSW 3 124419920 missense probably benign
R7124:1700006A11Rik UTSW 3 124414393 missense probably benign 0.04
R7248:1700006A11Rik UTSW 3 124414310 critical splice donor site probably null
R7351:1700006A11Rik UTSW 3 124412510 missense probably damaging 1.00
R7709:1700006A11Rik UTSW 3 124407685 missense probably damaging 1.00
R7773:1700006A11Rik UTSW 3 124412531 missense probably benign 0.00
R8193:1700006A11Rik UTSW 3 124419868 missense possibly damaging 0.84
X0063:1700006A11Rik UTSW 3 124419862 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGATTCTCATTTCTGGACAGAAGC -3'
(R):5'- CACTGTGCAGAGTGTGGATG -3'

Sequencing Primer
(F):5'- TTTCTGGACAGAAGCAAAAATCC -3'
(R):5'- CACTGTGCAGAGTGTGGATGATATTC -3'
Posted On2020-07-13