Incidental Mutation 'R8201:Ndufaf4'
ID635664
Institutional Source Beutler Lab
Gene Symbol Ndufaf4
Ensembl Gene ENSMUSG00000028261
Gene NameNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R8201 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location24898083-24905001 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24898197 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 11 (N11D)
Ref Sequence ENSEMBL: ENSMUSP00000029925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029925] [ENSMUST00000151249]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029925
AA Change: N11D

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029925
Gene: ENSMUSG00000028261
AA Change: N11D

DomainStartEndE-ValueType
Pfam:UPF0240 1 169 6.4e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151249
AA Change: N8D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117141
Gene: ENSMUSG00000028261
AA Change: N8D

DomainStartEndE-ValueType
Pfam:UPF0240 1 116 2.4e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NADH:ubiquinone oxidoreductase (complex I) catalyzes the transfer of electrons from NADH to ubiquinone (coenzyme Q) in the first step of the mitochondrial respiratory chain, resulting in the translocation of protons across the inner mitochondrial membrane. This gene encodes a complex I assembly factor. Mutations in this gene are a cause of mitochondrial complex I deficiency. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in Ndufaf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03001:Ndufaf4 APN 4 24901747 missense probably benign 0.44
R2128:Ndufaf4 UTSW 4 24898608 missense probably damaging 1.00
R2129:Ndufaf4 UTSW 4 24898608 missense probably damaging 1.00
R5666:Ndufaf4 UTSW 4 24898636 missense probably damaging 1.00
R5670:Ndufaf4 UTSW 4 24898636 missense probably damaging 1.00
R6021:Ndufaf4 UTSW 4 24901760 missense probably benign 0.02
R7393:Ndufaf4 UTSW 4 24903177 missense probably benign 0.00
R7519:Ndufaf4 UTSW 4 24901847 missense probably damaging 0.99
R7586:Ndufaf4 UTSW 4 24901829 missense probably damaging 0.98
R7997:Ndufaf4 UTSW 4 24901919 missense probably benign 0.01
R8245:Ndufaf4 UTSW 4 24898648 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GCTCATCCTTAAAGACTCCGG -3'
(R):5'- TCTTGGGGCAAACACTTGGAC -3'

Sequencing Primer
(F):5'- GACAACGCCCAGATGTCTG -3'
(R):5'- ACGAGAGTCTGCGTGCAG -3'
Posted On2020-07-13