Incidental Mutation 'R8201:Cyp2j7'
ID635665
Institutional Source Beutler Lab
Gene Symbol Cyp2j7
Ensembl Gene ENSMUSG00000081362
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 7
SynonymsCyp2j7-ps, OTTMUSG00000007941
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R8201 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location96195197-96236659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96195327 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 462 (I462N)
Ref Sequence ENSEMBL: ENSMUSP00000134331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162514]
Predicted Effect probably damaging
Transcript: ENSMUST00000162514
AA Change: I462N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134331
Gene: ENSMUSG00000081362
AA Change: I462N

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 44 499 3.7e-130 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in Cyp2j7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Cyp2j7 APN 4 96227512 splice site probably benign
IGL00426:Cyp2j7 APN 4 96227513 splice site probably null
IGL01505:Cyp2j7 APN 4 96227680 critical splice acceptor site probably null
IGL02100:Cyp2j7 APN 4 96236556 missense probably damaging 0.99
IGL02183:Cyp2j7 APN 4 96230147 splice site probably benign
IGL02596:Cyp2j7 APN 4 96215422 missense possibly damaging 0.56
IGL02661:Cyp2j7 APN 4 96236650 missense probably benign
IGL02723:Cyp2j7 APN 4 96230129 missense probably benign 0.33
IGL03053:Cyp2j7 APN 4 96230037 missense probably benign 0.00
IGL03159:Cyp2j7 APN 4 96227512 splice site probably benign
IGL03168:Cyp2j7 APN 4 96230037 missense probably benign 0.00
IGL03174:Cyp2j7 APN 4 96195370 nonsense probably null
PIT4449001:Cyp2j7 UTSW 4 96215338 missense probably damaging 0.96
R0016:Cyp2j7 UTSW 4 96202147 missense probably damaging 0.99
R0016:Cyp2j7 UTSW 4 96202147 missense probably damaging 0.99
R0392:Cyp2j7 UTSW 4 96199434 missense probably damaging 1.00
R1447:Cyp2j7 UTSW 4 96195293 missense possibly damaging 0.90
R1778:Cyp2j7 UTSW 4 96199390 missense probably damaging 1.00
R1876:Cyp2j7 UTSW 4 96217419 missense probably benign 0.01
R4105:Cyp2j7 UTSW 4 96199450 missense possibly damaging 0.84
R4106:Cyp2j7 UTSW 4 96199450 missense possibly damaging 0.84
R4107:Cyp2j7 UTSW 4 96199450 missense possibly damaging 0.84
R4108:Cyp2j7 UTSW 4 96199450 missense possibly damaging 0.84
R4438:Cyp2j7 UTSW 4 96217409 missense probably benign 0.01
R4660:Cyp2j7 UTSW 4 96195342 missense probably benign 0.29
R6193:Cyp2j7 UTSW 4 96195203 missense probably damaging 1.00
R6380:Cyp2j7 UTSW 4 96229974 critical splice donor site probably null
R6427:Cyp2j7 UTSW 4 96227667 missense probably damaging 0.96
R6624:Cyp2j7 UTSW 4 96227618 missense probably damaging 0.99
R7196:Cyp2j7 UTSW 4 96215414 missense probably benign 0.03
R7417:Cyp2j7 UTSW 4 96201988 critical splice donor site probably null
R7780:Cyp2j7 UTSW 4 96230019 missense probably benign 0.00
R8062:Cyp2j7 UTSW 4 96215350 missense probably null 1.00
R8097:Cyp2j7 UTSW 4 96215410 missense possibly damaging 0.95
R8279:Cyp2j7 UTSW 4 96228559 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGCCCAGAAGATTCAGAGC -3'
(R):5'- TGAATCAGGTTGTAATTGCTCAGTC -3'

Sequencing Primer
(F):5'- CAGAAGATTCAGAGCATATCTTCCTG -3'
(R):5'- CAGGTTGTAATTGCTCAGTCAAAAAG -3'
Posted On2020-07-13