Mutagenetix > Incidental Mutation

Incidental Mutation 'R8201:Dnajc6'

635666

Institutional Source

Beutler Lab

Gene Symbol

Dnajc6

Ensembl Gene

ENSMUSG00000028528

Gene Name

DnaJ heat shock protein family (Hsp40) member C6

Synonyms

auxilin, 2810027M23Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R8201 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101496648-101642799 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101618763 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 611 (A611V)

Ref Sequence

ENSEMBL: ENSMUSP00000102546 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038207] [ENSMUST00000094953] [ENSMUST00000106929] [ENSMUST00000106930] [ENSMUST00000106933]

AlphaFold

Q80TZ3

Predicted Effect

probably benign
Transcript: ENSMUST00000038207
AA Change: A581V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000044251
Gene: ENSMUSG00000028528
AA Change: A581V

Domain	Start	End	E-Value	Type
SCOP:d1d5ra2	88	244	1e-20	SMART
PTEN_C2	251	390	5.95e-42	SMART
low complexity region	502	521	N/A	INTRINSIC
low complexity region	554	569	N/A	INTRINSIC
low complexity region	679	694	N/A	INTRINSIC
low complexity region	719	735	N/A	INTRINSIC
low complexity region	829	840	N/A	INTRINSIC
DnaJ	873	934	2e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000094953
AA Change: A543V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000092560
Gene: ENSMUSG00000028528
AA Change: A543V

Domain	Start	End	E-Value	Type
SCOP:d1d5ra2	50	206	2e-20	SMART
PTEN_C2	213	352	5.95e-42	SMART
low complexity region	464	483	N/A	INTRINSIC
low complexity region	516	531	N/A	INTRINSIC
low complexity region	641	656	N/A	INTRINSIC
low complexity region	681	697	N/A	INTRINSIC
low complexity region	791	802	N/A	INTRINSIC
DnaJ	835	896	2e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106929
AA Change: A543V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000102542
Gene: ENSMUSG00000028528
AA Change: A543V

Domain	Start	End	E-Value	Type
SCOP:d1d5ra2	50	206	2e-20	SMART
PTEN_C2	213	352	5.95e-42	SMART
low complexity region	464	483	N/A	INTRINSIC
low complexity region	516	531	N/A	INTRINSIC
low complexity region	641	656	N/A	INTRINSIC
low complexity region	681	697	N/A	INTRINSIC
low complexity region	791	802	N/A	INTRINSIC
DnaJ	835	896	2e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106930
AA Change: A543V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000102543
Gene: ENSMUSG00000028528
AA Change: A543V

Domain	Start	End	E-Value	Type
SCOP:d1d5ra2	50	206	2e-20	SMART
PTEN_C2	213	352	5.95e-42	SMART
low complexity region	464	483	N/A	INTRINSIC
low complexity region	516	531	N/A	INTRINSIC
low complexity region	641	656	N/A	INTRINSIC
low complexity region	681	697	N/A	INTRINSIC
low complexity region	791	802	N/A	INTRINSIC
DnaJ	835	896	2e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106933
AA Change: A611V

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000102546
Gene: ENSMUSG00000028528
AA Change: A611V

Domain	Start	End	E-Value	Type
low complexity region	30	44	N/A	INTRINSIC
SCOP:d1d5ra2	118	274	1e-20	SMART
PTEN_C2	281	420	5.95e-42	SMART
low complexity region	532	551	N/A	INTRINSIC
low complexity region	584	599	N/A	INTRINSIC
low complexity region	709	724	N/A	INTRINSIC
low complexity region	749	765	N/A	INTRINSIC
low complexity region	859	870	N/A	INTRINSIC
DnaJ	903	964	2e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNAJC6 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus, a glycine/phenylalanine (G/F)-rich region, and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous and heterozygous for a knock-out allele exhibit postnatal lethality and decreased body weight with homozygotes exhibiting decreased synpatic vesicle recycling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	T	C	3: 124,401,397	E543G	probably benign	Het
2210408I21Rik	T	A	13: 77,193,159	N302K	possibly damaging	Het
Apbb2	T	C	5: 66,309,115	N609S	probably benign	Het
Atp10a	G	T	7: 58,819,676	G1092*	probably null	Het
Ccdc150	A	G	1: 54,329,487	N618S	probably benign	Het
Cct4	T	A	11: 22,999,115	V287E	probably damaging	Het
Cyp2j7	A	T	4: 96,195,327	I462N	probably damaging	Het
Dusp10	C	A	1: 184,037,005	A56E	possibly damaging	Het
Fam189b	T	C	3: 89,185,808	V291A	probably damaging	Het
Fat3	A	C	9: 15,997,477	C2410G	possibly damaging	Het
Fcgrt	T	A	7: 45,095,210	Q274L	possibly damaging	Het
Fdxacb1	G	T	9: 50,770,155		probably benign	Het
Fubp1	T	A	3: 152,222,186	I424N	probably damaging	Het
Gm5114	T	A	7: 39,410,949	T159S	probably damaging	Het
Gm7168	T	C	17: 13,949,780	C470R	probably benign	Het
Hebp1	A	G	6: 135,137,908	V185A	possibly damaging	Het
Il18rap	G	T	1: 40,539,269	R280I	possibly damaging	Het
Mamdc4	T	C	2: 25,566,081	N771S	probably damaging	Het
Ndufaf4	A	G	4: 24,898,197	N11D	possibly damaging	Het
Nkiras1	T	C	14: 18,276,908		probably benign	Het
Noct	T	C	3: 51,248,023	S135P	probably benign	Het
Olfr18	T	C	9: 20,314,612	M103V	probably benign	Het
Olfr317	A	C	11: 58,733,114	F17C	probably damaging	Het
Olfr330	A	T	11: 58,529,039	*316R	noncoding transcript	Het
Olfr382	T	A	11: 73,517,073	N42I	probably damaging	Het
Olfr873	G	T	9: 20,301,021	G271C	probably damaging	Het
Pcdhac1	A	T	18: 37,090,839	H235L	probably benign	Het
Pcdhb22	G	T	18: 37,518,465		probably benign	Het
Pdlim1	A	T	19: 40,230,514	D224E	probably benign	Het
Plpp3	G	T	4: 105,219,358	G223W	probably damaging	Het
Rcan3	A	G	4: 135,420,373	F81S	probably damaging	Het
Sel1l2	A	C	2: 140,266,392	Y191D	probably damaging	Het
Supt16	A	G	14: 52,170,990	F833L	probably damaging	Het
Tchh	T	C	3: 93,443,474	F74L	probably damaging	Het
Tgfbr3	T	C	5: 107,130,565	D725G	probably benign	Het
Tmem14c	C	T	13: 41,017,710	P10S	probably benign	Het
Ubb	G	A	11: 62,552,227	A28T	probably benign	Het
Vars2	A	T	17: 35,658,310	V833E	probably benign	Het
Zfyve9	T	C	4: 108,650,277	D528G	possibly damaging	Het

Other mutations in Dnajc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Dnajc6	APN	4	101508089	intron	probably benign
IGL02336:Dnajc6	APN	4	101614286	splice site	probably null
IGL02551:Dnajc6	APN	4	101639353	missense	probably damaging	1.00
IGL02801:Dnajc6	APN	4	101597813	missense	probably benign	0.33
IGL02887:Dnajc6	APN	4	101639300	missense	probably damaging	1.00
IGL03107:Dnajc6	APN	4	101616860	missense	probably damaging	1.00
IGL03271:Dnajc6	APN	4	101508077	intron	probably benign
R0091:Dnajc6	UTSW	4	101616777	splice site	probably benign
R0384:Dnajc6	UTSW	4	101598956	missense	probably damaging	1.00
R0546:Dnajc6	UTSW	4	101635191	missense	probably damaging	0.99
R0689:Dnajc6	UTSW	4	101611253	missense	possibly damaging	0.91
R1239:Dnajc6	UTSW	4	101635116	missense	probably damaging	0.98
R1421:Dnajc6	UTSW	4	101611316	missense	probably damaging	0.97
R1424:Dnajc6	UTSW	4	101639347	missense	possibly damaging	0.92
R1563:Dnajc6	UTSW	4	101599137	missense	probably damaging	1.00
R1608:Dnajc6	UTSW	4	101599167	missense	probably damaging	1.00
R1757:Dnajc6	UTSW	4	101597831	missense	probably damaging	1.00
R1856:Dnajc6	UTSW	4	101598988	missense	probably damaging	1.00
R2032:Dnajc6	UTSW	4	101614238	missense	probably benign	0.39
R2518:Dnajc6	UTSW	4	101612930	missense	probably damaging	0.99
R4028:Dnajc6	UTSW	4	101616857	missense	probably damaging	1.00
R4088:Dnajc6	UTSW	4	101639396	missense	probably damaging	1.00
R4601:Dnajc6	UTSW	4	101611264	missense	probably damaging	1.00
R4602:Dnajc6	UTSW	4	101611264	missense	probably damaging	1.00
R4610:Dnajc6	UTSW	4	101611264	missense	probably damaging	1.00
R4755:Dnajc6	UTSW	4	101550799	missense	probably damaging	1.00
R4878:Dnajc6	UTSW	4	101599034	intron	probably benign
R4938:Dnajc6	UTSW	4	101636813	missense	probably damaging	1.00
R5373:Dnajc6	UTSW	4	101615627	missense	probably damaging	0.99
R5391:Dnajc6	UTSW	4	101628158	critical splice donor site	probably null
R5435:Dnajc6	UTSW	4	101606610	missense	probably damaging	0.99
R5760:Dnajc6	UTSW	4	101618642	missense	probably benign	0.39
R6044:Dnajc6	UTSW	4	101616577	missense	probably benign	0.22
R6086:Dnajc6	UTSW	4	101597807	missense	probably benign	0.45
R6460:Dnajc6	UTSW	4	101615598	missense	probably damaging	1.00
R6495:Dnajc6	UTSW	4	101635065	nonsense	probably null
R6956:Dnajc6	UTSW	4	101614273	missense	probably damaging	0.97
R7072:Dnajc6	UTSW	4	101615615	missense	probably damaging	1.00
R7155:Dnajc6	UTSW	4	101612945	missense	probably damaging	1.00
R7192:Dnajc6	UTSW	4	101597803	missense	probably benign	0.02
R7226:Dnajc6	UTSW	4	101639372	missense	probably damaging	1.00
R7298:Dnajc6	UTSW	4	101606611	missense	probably benign	0.09
R7612:Dnajc6	UTSW	4	101597926	missense	probably benign	0.40
R7622:Dnajc6	UTSW	4	101640491	missense	probably damaging	1.00
R7652:Dnajc6	UTSW	4	101606677	missense	probably damaging	0.98
R7789:Dnajc6	UTSW	4	101618532	missense	possibly damaging	0.82
R8010:Dnajc6	UTSW	4	101618414	missense	probably benign	0.01
R8305:Dnajc6	UTSW	4	101623787	missense	probably damaging	1.00
R8912:Dnajc6	UTSW	4	101611316	missense	probably damaging	1.00
R9012:Dnajc6	UTSW	4	101612959	missense	probably damaging	1.00
R9052:Dnajc6	UTSW	4	101639420	missense	probably damaging	0.97
R9091:Dnajc6	UTSW	4	101639362	missense	possibly damaging	0.80
R9160:Dnajc6	UTSW	4	101613061	unclassified	probably benign
R9258:Dnajc6	UTSW	4	101618616	missense	probably benign	0.07
R9270:Dnajc6	UTSW	4	101639362	missense	possibly damaging	0.80
R9294:Dnajc6	UTSW	4	101550857	critical splice donor site	probably null
R9386:Dnajc6	UTSW	4	101636901	critical splice donor site	probably null
R9664:Dnajc6	UTSW	4	101618624	missense	probably benign	0.04
Z1088:Dnajc6	UTSW	4	101639329	missense	probably damaging	1.00
Z1177:Dnajc6	UTSW	4	101639428	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TGATAAGCCTCATGGAGCCAAG -3'
(R):5'- ACCCCATATCTTTCTACCAAAATGG -3'

Sequencing Primer
(F):5'- AGGAAGTGGACCTCCTGG -3'
(R):5'- GTGTTGTATGTTTTTCCAAGAAACTG -3'

Posted On

2020-07-13