Incidental Mutation 'R8201:Zfyve9'
ID635668
Institutional Source Beutler Lab
Gene Symbol Zfyve9
Ensembl Gene ENSMUSG00000034557
Gene Namezinc finger, FYVE domain containing 9
SynonymsMadhip
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.628) question?
Stock #R8201 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location108637466-108780798 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108650277 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 528 (D528G)
Ref Sequence ENSEMBL: ENSMUSP00000039852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042185] [ENSMUST00000106657] [ENSMUST00000106658]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042185
AA Change: D528G

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039852
Gene: ENSMUSG00000034557
AA Change: D528G

DomainStartEndE-ValueType
Blast:FYVE 7 40 4e-7 BLAST
Pfam:SARA 52 92 1e-25 PFAM
Pfam:DUF3480 328 681 1.4e-189 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106657
AA Change: D1219G

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102268
Gene: ENSMUSG00000034557
AA Change: D1219G

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 7e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:SARA 745 783 1.3e-22 PFAM
Pfam:DUF3480 1020 1372 1e-178 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106658
AA Change: D1160G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102269
Gene: ENSMUSG00000034557
AA Change: D1160G

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 8e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:DUF3480 960 1313 5.5e-189 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a double zinc finger motif-containing protein that participates in the transforming growth factor-beta (TGFB) signalling pathway. The encoded protein interacts directly with SMAD2 and SMAD3, and recruits SMAD2 to the TGFB receptor. There are multiple pseudogenes for this gene on chromosomes 2, 15, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Other mutations in Zfyve9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Zfyve9 APN 4 108642107 missense possibly damaging 0.85
IGL01161:Zfyve9 APN 4 108681064 missense probably damaging 1.00
IGL01404:Zfyve9 APN 4 108682151 missense probably damaging 1.00
IGL01451:Zfyve9 APN 4 108682260 missense probably damaging 0.98
IGL01655:Zfyve9 APN 4 108642092 missense probably damaging 1.00
IGL02567:Zfyve9 APN 4 108674523 missense probably damaging 1.00
IGL02593:Zfyve9 APN 4 108682223 missense possibly damaging 0.73
IGL03169:Zfyve9 APN 4 108695825 missense probably damaging 1.00
IGL03206:Zfyve9 APN 4 108689209 missense possibly damaging 0.88
IGL03288:Zfyve9 APN 4 108723799 splice site probably benign
R0008:Zfyve9 UTSW 4 108718705 missense possibly damaging 0.92
R0008:Zfyve9 UTSW 4 108718705 missense possibly damaging 0.92
R0104:Zfyve9 UTSW 4 108718163 missense probably damaging 1.00
R0104:Zfyve9 UTSW 4 108718163 missense probably damaging 1.00
R0362:Zfyve9 UTSW 4 108680969 missense probably damaging 0.96
R0502:Zfyve9 UTSW 4 108719764 nonsense probably null
R0503:Zfyve9 UTSW 4 108719764 nonsense probably null
R0557:Zfyve9 UTSW 4 108674511 missense probably damaging 0.98
R0835:Zfyve9 UTSW 4 108718669 missense probably damaging 0.99
R1215:Zfyve9 UTSW 4 108650229 missense probably benign 0.32
R1245:Zfyve9 UTSW 4 108693311 intron probably benign
R1527:Zfyve9 UTSW 4 108695767 critical splice donor site probably null
R1638:Zfyve9 UTSW 4 108684907 critical splice donor site probably null
R1653:Zfyve9 UTSW 4 108660577 nonsense probably null
R1728:Zfyve9 UTSW 4 108718501 missense possibly damaging 0.80
R1729:Zfyve9 UTSW 4 108718501 missense possibly damaging 0.80
R1861:Zfyve9 UTSW 4 108682295 splice site probably benign
R1983:Zfyve9 UTSW 4 108689189 missense possibly damaging 0.94
R2050:Zfyve9 UTSW 4 108718603 missense probably benign 0.05
R2050:Zfyve9 UTSW 4 108719303 missense possibly damaging 0.94
R2246:Zfyve9 UTSW 4 108689264 missense possibly damaging 0.70
R2338:Zfyve9 UTSW 4 108660614 missense probably damaging 1.00
R2697:Zfyve9 UTSW 4 108695819 missense probably damaging 0.99
R3522:Zfyve9 UTSW 4 108719743 missense probably benign 0.45
R4030:Zfyve9 UTSW 4 108719701 missense possibly damaging 0.61
R4247:Zfyve9 UTSW 4 108719192 missense probably benign 0.28
R4273:Zfyve9 UTSW 4 108680976 missense probably damaging 1.00
R4720:Zfyve9 UTSW 4 108644368 missense possibly damaging 0.94
R4835:Zfyve9 UTSW 4 108717998 missense possibly damaging 0.70
R4871:Zfyve9 UTSW 4 108680986 missense probably damaging 1.00
R4881:Zfyve9 UTSW 4 108727491 splice site probably null
R4974:Zfyve9 UTSW 4 108680900 critical splice donor site probably null
R5024:Zfyve9 UTSW 4 108691669 missense probably benign 0.18
R5481:Zfyve9 UTSW 4 108644349 missense probably damaging 1.00
R5660:Zfyve9 UTSW 4 108719168 missense probably benign
R5965:Zfyve9 UTSW 4 108691681 missense possibly damaging 0.53
R5996:Zfyve9 UTSW 4 108719360 missense probably benign 0.07
R6315:Zfyve9 UTSW 4 108674488 missense probably damaging 1.00
R6772:Zfyve9 UTSW 4 108639269 missense probably damaging 1.00
R6865:Zfyve9 UTSW 4 108644361 missense possibly damaging 0.71
R7112:Zfyve9 UTSW 4 108650322 missense probably benign 0.00
R7258:Zfyve9 UTSW 4 108656954 missense possibly damaging 0.94
R7266:Zfyve9 UTSW 4 108718547 missense possibly damaging 0.62
R7287:Zfyve9 UTSW 4 108718256 missense probably benign 0.00
R7356:Zfyve9 UTSW 4 108719015 missense probably benign 0.01
R7389:Zfyve9 UTSW 4 108693318 critical splice donor site probably null
R7729:Zfyve9 UTSW 4 108691776 missense probably benign 0.01
R7780:Zfyve9 UTSW 4 108719101 missense possibly damaging 0.81
R7801:Zfyve9 UTSW 4 108684995 missense possibly damaging 0.50
R8069:Zfyve9 UTSW 4 108685018 missense probably benign 0.32
R8221:Zfyve9 UTSW 4 108719680 missense possibly damaging 0.77
Z1176:Zfyve9 UTSW 4 108642207 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGTCAACTCTGAAGCTGCG -3'
(R):5'- CTTCAGTGCGAGTTTCAGCTC -3'

Sequencing Primer
(F):5'- CAACTCTGAAGCTGCGGTGTG -3'
(R):5'- GTGCGAGTTTCAGCTCAAAACTG -3'
Posted On2020-07-13