Incidental Mutation 'R8201:Hebp1'
ID635672
Institutional Source Beutler Lab
Gene Symbol Hebp1
Ensembl Gene ENSMUSG00000042770
Gene Nameheme binding protein 1
Synonymsp22 HBP
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R8201 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location135137522-135198022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135137908 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 185 (V185A)
Ref Sequence ENSEMBL: ENSMUSP00000042232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045855]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045855
AA Change: V185A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042232
Gene: ENSMUSG00000042770
AA Change: V185A

DomainStartEndE-ValueType
Pfam:SOUL 13 188 2.1e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The full-length protein encoded by this gene is an intracellular tetrapyrrole-binding protein. This protein includes a natural chemoattractant peptide of 21 amino acids at the N-terminus, which is a natural ligand for formyl peptide receptor-like receptor 2 (FPRL2) and promotes calcium mobilization and chemotaxis in monocytes and dendritic cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in Hebp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02471:Hebp1 APN 6 135155276 missense probably benign 0.02
IGL02957:Hebp1 APN 6 135137992 missense probably benign
IGL03194:Hebp1 APN 6 135155192 missense probably benign 0.02
R0352:Hebp1 UTSW 6 135152920 missense possibly damaging 0.86
R6012:Hebp1 UTSW 6 135168057 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCAAGAATGATGCTGCCAATC -3'
(R):5'- AGACTTGTCTTCTCCGCAAG -3'

Sequencing Primer
(F):5'- CTTGGCTTATTTCAGAAAATCAGCAG -3'
(R):5'- GCAAGGTCATGTCCTTTCTTACCAG -3'
Posted On2020-07-13