Incidental Mutation 'R8201:Gm5114'
ID635673
Institutional Source Beutler Lab
Gene Symbol Gm5114
Ensembl Gene ENSMUSG00000053742
Gene Namepredicted gene 5114
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R8201 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location39407294-39413160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39410949 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 159 (T159S)
Ref Sequence ENSEMBL: ENSMUSP00000103652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108017]
Predicted Effect probably damaging
Transcript: ENSMUST00000108017
AA Change: T159S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103652
Gene: ENSMUSG00000053742
AA Change: T159S

DomainStartEndE-ValueType
Pfam:DUF4629 435 580 2.5e-65 PFAM
low complexity region 709 726 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in Gm5114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Gm5114 APN 7 39410647 splice site probably benign
IGL01295:Gm5114 APN 7 39407817 missense probably damaging 1.00
IGL01349:Gm5114 APN 7 39409107 missense probably benign
IGL01633:Gm5114 APN 7 39408066 missense probably benign
IGL01634:Gm5114 APN 7 39408647 missense probably benign
IGL02072:Gm5114 APN 7 39411402 missense probably benign 0.00
FR4304:Gm5114 UTSW 7 39411105 missense probably benign
FR4304:Gm5114 UTSW 7 39411106 missense probably benign 0.00
R0034:Gm5114 UTSW 7 39408858 missense possibly damaging 0.83
R0127:Gm5114 UTSW 7 39408456 missense probably benign 0.00
R0328:Gm5114 UTSW 7 39408461 missense probably damaging 1.00
R0387:Gm5114 UTSW 7 39408809 missense probably benign 0.15
R0693:Gm5114 UTSW 7 39408764 missense probably benign 0.00
R1006:Gm5114 UTSW 7 39409086 missense probably damaging 1.00
R2039:Gm5114 UTSW 7 39409188 missense probably damaging 1.00
R3433:Gm5114 UTSW 7 39409197 missense probably benign 0.02
R3834:Gm5114 UTSW 7 39408737 missense possibly damaging 0.69
R4320:Gm5114 UTSW 7 39407627 missense probably damaging 1.00
R5214:Gm5114 UTSW 7 39408368 missense probably benign 0.19
R5443:Gm5114 UTSW 7 39408865 missense probably benign 0.00
R5471:Gm5114 UTSW 7 39409110 nonsense probably null
R5707:Gm5114 UTSW 7 39411276 missense probably benign 0.01
R6129:Gm5114 UTSW 7 39408600 missense possibly damaging 0.71
R6234:Gm5114 UTSW 7 39409344 missense probably benign 0.19
R6326:Gm5114 UTSW 7 39408155 missense probably benign
R6443:Gm5114 UTSW 7 39407717 missense possibly damaging 0.91
R6530:Gm5114 UTSW 7 39408090 missense probably damaging 1.00
R6743:Gm5114 UTSW 7 39408573 missense probably benign 0.42
R6770:Gm5114 UTSW 7 39408543 missense possibly damaging 0.94
R6885:Gm5114 UTSW 7 39408156 missense probably benign 0.01
R6980:Gm5114 UTSW 7 39409200 missense probably benign 0.01
R7100:Gm5114 UTSW 7 39408284 missense possibly damaging 0.52
R7215:Gm5114 UTSW 7 39411371 missense probably benign 0.02
R7254:Gm5114 UTSW 7 39408966 missense probably benign 0.35
R7343:Gm5114 UTSW 7 39408756 missense probably damaging 1.00
R7366:Gm5114 UTSW 7 39409344 missense possibly damaging 0.69
R7474:Gm5114 UTSW 7 39407980 missense probably benign 0.01
R7499:Gm5114 UTSW 7 39409065 missense possibly damaging 0.55
R8022:Gm5114 UTSW 7 39409376 missense probably benign
R8121:Gm5114 UTSW 7 39408128 missense probably benign 0.15
R8212:Gm5114 UTSW 7 39411252 missense probably benign 0.18
R8321:Gm5114 UTSW 7 39410849 missense possibly damaging 0.85
Z1088:Gm5114 UTSW 7 39408447 missense probably damaging 1.00
Z1177:Gm5114 UTSW 7 39409326 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGGCTGAATCTCCTGTAGC -3'
(R):5'- CTCAAGTGGGATTGCACTGG -3'

Sequencing Primer
(F):5'- ACCTTCTCTGGTTGGAGCACAG -3'
(R):5'- TTGCACTGGAAGCACACATAG -3'
Posted On2020-07-13