Incidental Mutation 'R8201:Fcgrt'
ID635674
Institutional Source Beutler Lab
Gene Symbol Fcgrt
Ensembl Gene ENSMUSG00000003420
Gene NameFc receptor, IgG, alpha chain transporter
Synonymsneonatal Fc receptor, FcRn
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R8201 (G1)
Quality Score215.009
Status Not validated
Chromosome7
Chromosomal Location45092990-45103851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45095210 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 274 (Q274L)
Ref Sequence ENSEMBL: ENSMUSP00000003512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003512] [ENSMUST00000019683] [ENSMUST00000209761] [ENSMUST00000210469] [ENSMUST00000210527] [ENSMUST00000210642] [ENSMUST00000210734] [ENSMUST00000211352]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003512
AA Change: Q274L

PolyPhen 2 Score 0.542 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000003512
Gene: ENSMUSG00000003420
AA Change: Q274L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 24 197 1.2e-59 PFAM
IGc1 216 285 2.42e-11 SMART
transmembrane domain 300 322 N/A INTRINSIC
low complexity region 333 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019683
SMART Domains Protein: ENSMUSP00000019683
Gene: ENSMUSG00000019539

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Blast:EFh 79 109 9e-9 BLAST
EFh 117 145 1.23e1 SMART
Blast:EFh 167 195 1e-7 BLAST
EFh 204 232 1.62e0 SMART
Blast:EFh 244 272 7e-6 BLAST
EFh 281 309 1.64e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209761
Predicted Effect probably benign
Transcript: ENSMUST00000210469
Predicted Effect probably benign
Transcript: ENSMUST00000210527
Predicted Effect possibly damaging
Transcript: ENSMUST00000210642
AA Change: Q278L

PolyPhen 2 Score 0.542 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000210734
Predicted Effect probably benign
Transcript: ENSMUST00000211352
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor that binds the Fc region of monomeric immunoglobulin G. The encoded protein transfers immunoglobulin G antibodies from mother to fetus across the placenta. This protein also binds immunoglobulin G to protect the antibody from degradation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous mutation of this gene results in defective perinatal transport of maternal IgG, increased clearance of IgG, and diminished IgG antibody response after immunization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in Fcgrt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Fcgrt APN 7 45093328 missense probably damaging 1.00
IGL02024:Fcgrt APN 7 45095258 missense probably damaging 0.96
R0355:Fcgrt UTSW 7 45103069 start codon destroyed unknown
R0408:Fcgrt UTSW 7 45101939 missense probably damaging 1.00
R4989:Fcgrt UTSW 7 45101948 missense probably benign 0.09
R6156:Fcgrt UTSW 7 45102060 missense probably benign 0.05
R6190:Fcgrt UTSW 7 45102198 splice site probably null
R7001:Fcgrt UTSW 7 45102042 missense probably benign 0.03
R7177:Fcgrt UTSW 7 45101997 missense probably benign 0.00
R7605:Fcgrt UTSW 7 45095251 nonsense probably null
R7729:Fcgrt UTSW 7 45095373 missense probably damaging 1.00
R8377:Fcgrt UTSW 7 45102563 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCACAGAGCTAATGGAG -3'
(R):5'- TAGCCTAGCCTAACTGCTGG -3'

Sequencing Primer
(F):5'- GAGGTCCTGAATTCAATTCCCAG -3'
(R):5'- ATTGCCTGTGTCCCTGCAGAG -3'
Posted On2020-07-13