Incidental Mutation 'R8201:Atp10a'
ID635675
Institutional Source Beutler Lab
Gene Symbol Atp10a
Ensembl Gene ENSMUSG00000025324
Gene NameATPase, class V, type 10A
SynonymsAtp10c, pfatp
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R8201 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location58656166-58829420 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 58819676 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 1092 (G1092*)
Ref Sequence ENSEMBL: ENSMUSP00000129811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168747]
Predicted Effect probably null
Transcript: ENSMUST00000168747
AA Change: G1092*
SMART Domains Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: G1092*

DomainStartEndE-ValueType
low complexity region 15 32 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 55 114 5.2e-23 PFAM
Pfam:E1-E2_ATPase 120 393 6.6e-10 PFAM
low complexity region 633 643 N/A INTRINSIC
Pfam:Cation_ATPase 685 791 1.5e-7 PFAM
Pfam:HAD 697 1054 2.1e-12 PFAM
Pfam:PhoLip_ATPase_C 1071 1316 1.1e-76 PFAM
low complexity region 1458 1477 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in Atp10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Atp10a APN 7 58794482 missense probably benign 0.06
IGL00973:Atp10a APN 7 58807470 missense probably damaging 1.00
IGL00984:Atp10a APN 7 58658741 missense probably damaging 1.00
IGL01086:Atp10a APN 7 58824318 missense probably damaging 0.96
IGL01296:Atp10a APN 7 58813625 missense probably benign 0.02
IGL01731:Atp10a APN 7 58797562 missense probably benign 0.16
IGL02081:Atp10a APN 7 58827856 missense possibly damaging 0.62
IGL02095:Atp10a APN 7 58807393 missense probably damaging 1.00
IGL02549:Atp10a APN 7 58819733 missense probably benign 0.00
IGL02558:Atp10a APN 7 58819642 missense probably damaging 0.98
IGL02659:Atp10a APN 7 58813631 missense probably benign
IGL02986:Atp10a APN 7 58828721 missense probably benign
IGL03218:Atp10a APN 7 58788448 critical splice donor site probably null
PIT4260001:Atp10a UTSW 7 58791118 nonsense probably null
PIT4445001:Atp10a UTSW 7 58803467 missense probably damaging 0.98
PIT4810001:Atp10a UTSW 7 58813848 missense probably damaging 0.99
R0091:Atp10a UTSW 7 58774046 splice site probably benign
R0349:Atp10a UTSW 7 58803467 missense probably damaging 0.98
R0426:Atp10a UTSW 7 58784734 missense probably benign 0.00
R0609:Atp10a UTSW 7 58819740 splice site probably null
R0722:Atp10a UTSW 7 58816183 missense possibly damaging 0.75
R0741:Atp10a UTSW 7 58828589 missense possibly damaging 0.90
R1172:Atp10a UTSW 7 58803766 missense probably benign 0.05
R1342:Atp10a UTSW 7 58816146 splice site probably benign
R1648:Atp10a UTSW 7 58784827 missense probably damaging 1.00
R1715:Atp10a UTSW 7 58786505 missense probably damaging 0.98
R1737:Atp10a UTSW 7 58827238 splice site probably benign
R1799:Atp10a UTSW 7 58824434 missense probably damaging 1.00
R1909:Atp10a UTSW 7 58828712 missense probably benign 0.12
R1918:Atp10a UTSW 7 58827935 missense possibly damaging 0.82
R2031:Atp10a UTSW 7 58827930 nonsense probably null
R2080:Atp10a UTSW 7 58824327 missense probably damaging 0.97
R2424:Atp10a UTSW 7 58794555 missense probably benign 0.16
R2696:Atp10a UTSW 7 58813618 missense probably benign 0.00
R3932:Atp10a UTSW 7 58827104 missense possibly damaging 0.69
R4198:Atp10a UTSW 7 58813686 missense probably damaging 1.00
R4453:Atp10a UTSW 7 58658500 small deletion probably benign
R4632:Atp10a UTSW 7 58807438 missense possibly damaging 0.48
R4661:Atp10a UTSW 7 58658500 small deletion probably benign
R4782:Atp10a UTSW 7 58791095 missense probably benign
R4888:Atp10a UTSW 7 58785307 missense probably damaging 1.00
R4935:Atp10a UTSW 7 58813764 missense probably damaging 1.00
R5051:Atp10a UTSW 7 58740246 frame shift probably null
R5213:Atp10a UTSW 7 58773983 missense probably damaging 0.99
R5617:Atp10a UTSW 7 58803675 missense probably benign 0.06
R5834:Atp10a UTSW 7 58658618 missense probably benign 0.01
R5885:Atp10a UTSW 7 58813800 missense possibly damaging 0.92
R6013:Atp10a UTSW 7 58797790 missense probably benign 0.05
R6136:Atp10a UTSW 7 58828340 missense probably benign
R6269:Atp10a UTSW 7 58803739 missense possibly damaging 0.51
R6380:Atp10a UTSW 7 58819684 nonsense probably null
R6743:Atp10a UTSW 7 58797814 missense possibly damaging 0.89
R6875:Atp10a UTSW 7 58797352 missense probably benign 0.01
R6975:Atp10a UTSW 7 58773985 missense probably damaging 1.00
R7082:Atp10a UTSW 7 58658819 missense probably damaging 1.00
R7203:Atp10a UTSW 7 58786473 missense probably benign
R7224:Atp10a UTSW 7 58797471 missense probably benign 0.00
R7287:Atp10a UTSW 7 58827269 missense probably damaging 1.00
R7437:Atp10a UTSW 7 58658540 missense unknown
R7474:Atp10a UTSW 7 58658527 missense unknown
R7530:Atp10a UTSW 7 58773976 missense probably benign 0.02
R7561:Atp10a UTSW 7 58827133 missense probably damaging 0.98
R7743:Atp10a UTSW 7 58803709 missense probably damaging 1.00
R7767:Atp10a UTSW 7 58658849 missense probably damaging 1.00
R7861:Atp10a UTSW 7 58788359 missense probably damaging 1.00
R7903:Atp10a UTSW 7 58658822 missense probably damaging 1.00
R8015:Atp10a UTSW 7 58803497 missense probably benign 0.00
R8166:Atp10a UTSW 7 58807522 missense possibly damaging 0.46
Z1176:Atp10a UTSW 7 58788447 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCATTCATGAGCAACAGGG -3'
(R):5'- TACAAGGCAAGGCTAAGATCAC -3'

Sequencing Primer
(F):5'- AGCCACCCTTAGTAATGTGTTAGGC -3'
(R):5'- GGCAAGGCTAAGATCACAGACAAAC -3'
Posted On2020-07-13