Incidental Mutation 'R8201:Olfr873'
ID635677
Institutional Source Beutler Lab
Gene Symbol Olfr873
Ensembl Gene ENSMUSG00000049028
Gene Nameolfactory receptor 873
SynonymsGA_x6K02T2PVTD-14040245-14041204, MOR145-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R8201 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location20298532-20303599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 20301021 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 271 (G271C)
Ref Sequence ENSEMBL: ENSMUSP00000054778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053919]
Predicted Effect probably damaging
Transcript: ENSMUST00000053919
AA Change: G271C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054778
Gene: ENSMUSG00000049028
AA Change: G271C

DomainStartEndE-ValueType
Pfam:7tm_4 41 317 1.7e-52 PFAM
Pfam:7TM_GPCR_Srsx 45 315 1.6e-8 PFAM
Pfam:7tm_1 51 300 3e-21 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in Olfr873
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02122:Olfr873 APN 9 20300584 missense probably damaging 1.00
IGL02268:Olfr873 APN 9 20300292 missense probably damaging 1.00
IGL02416:Olfr873 APN 9 20300245 missense probably benign 0.01
IGL03124:Olfr873 APN 9 20301163 missense probably benign 0.00
R0147:Olfr873 UTSW 9 20301091 missense probably damaging 1.00
R0148:Olfr873 UTSW 9 20301091 missense probably damaging 1.00
R0266:Olfr873 UTSW 9 20301158 missense probably benign 0.01
R0831:Olfr873 UTSW 9 20300565 missense probably benign 0.20
R1456:Olfr873 UTSW 9 20300838 missense probably benign 0.35
R1894:Olfr873 UTSW 9 20300337 missense probably benign 0.23
R1928:Olfr873 UTSW 9 20301058 missense probably benign 0.12
R2135:Olfr873 UTSW 9 20300297 missense probably benign 0.00
R2379:Olfr873 UTSW 9 20300667 missense possibly damaging 0.87
R2911:Olfr873 UTSW 9 20300479 missense possibly damaging 0.60
R3788:Olfr873 UTSW 9 20300370 missense probably benign 0.13
R4657:Olfr873 UTSW 9 20300623 missense probably damaging 1.00
R5754:Olfr873 UTSW 9 20301094 missense probably damaging 1.00
R6291:Olfr873 UTSW 9 20300603 missense probably damaging 1.00
R6410:Olfr873 UTSW 9 20300452 missense probably damaging 1.00
R7014:Olfr873 UTSW 9 20300663 nonsense probably null
R7521:Olfr873 UTSW 9 20300740 missense probably benign 0.00
R8355:Olfr873 UTSW 9 20300419 missense probably damaging 1.00
R8455:Olfr873 UTSW 9 20300419 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGTGACCCTGCACAAC -3'
(R):5'- TCTAAATGGGTGCCACAGG -3'

Sequencing Primer
(F):5'- GTGACCCTGCACAACTCCTTAATC -3'
(R):5'- AGGCCCTACTATTACAACATTCTTC -3'
Posted On2020-07-13