Incidental Mutation 'R8201:Fdxacb1'
ID635679
Institutional Source Beutler Lab
Gene Symbol Fdxacb1
Ensembl Gene ENSMUSG00000037845
Gene Nameferredoxin-fold anticodon binding domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8201 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location50768236-50773348 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 50770155 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034561] [ENSMUST00000042391] [ENSMUST00000042468] [ENSMUST00000042576] [ENSMUST00000176145] [ENSMUST00000176238] [ENSMUST00000176335] [ENSMUST00000177384] [ENSMUST00000177546]
Predicted Effect probably benign
Transcript: ENSMUST00000034561
SMART Domains Protein: ENSMUSP00000034561
Gene: ENSMUSG00000032059

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 482 3.5e-127 PFAM
low complexity region 598 611 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000042391
SMART Domains Protein: ENSMUSP00000037082
Gene: ENSMUSG00000037845

DomainStartEndE-ValueType
Pfam:DUF2431 7 176 1.4e-44 PFAM
low complexity region 258 269 N/A INTRINSIC
SCOP:d1jjca_ 487 516 6e-4 SMART
FDX-ACB 528 622 5.88e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042468
SMART Domains Protein: ENSMUSP00000041803
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 1 149 7.7e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042576
SMART Domains Protein: ENSMUSP00000046890
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 15 164 1.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176145
SMART Domains Protein: ENSMUSP00000135796
Gene: ENSMUSG00000037845

DomainStartEndE-ValueType
Pfam:DUF2431 7 115 4.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176238
SMART Domains Protein: ENSMUSP00000135679
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 1 70 4.2e-47 PFAM
Pfam:DUF1143 68 126 5.3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176335
SMART Domains Protein: ENSMUSP00000135658
Gene: ENSMUSG00000037845

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
SCOP:d1jjca_ 285 314 3e-4 SMART
FDX-ACB 326 420 5.88e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177384
Predicted Effect probably benign
Transcript: ENSMUST00000177546
SMART Domains Protein: ENSMUSP00000134870
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 13 72 3.3e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a ferredoxin-fold anticodon-binding domain which is contained in a subset of phenylalanyl tRNA synthetases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in Fdxacb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02403:Fdxacb1 APN 9 50771563 missense possibly damaging 0.75
IGL02828:Fdxacb1 APN 9 50771564 missense possibly damaging 0.75
IGL02799:Fdxacb1 UTSW 9 50772596 missense probably benign 0.01
R0755:Fdxacb1 UTSW 9 50771725 missense possibly damaging 0.87
R1283:Fdxacb1 UTSW 9 50768694 missense possibly damaging 0.79
R1395:Fdxacb1 UTSW 9 50772496 frame shift probably null
R1991:Fdxacb1 UTSW 9 50771646 missense probably benign 0.00
R2103:Fdxacb1 UTSW 9 50771646 missense probably benign 0.00
R2273:Fdxacb1 UTSW 9 50772021 missense probably benign 0.01
R2913:Fdxacb1 UTSW 9 50768399 missense probably benign 0.05
R2914:Fdxacb1 UTSW 9 50768399 missense probably benign 0.05
R4289:Fdxacb1 UTSW 9 50772579 missense probably damaging 0.99
R4492:Fdxacb1 UTSW 9 50770247 missense probably damaging 0.99
R4668:Fdxacb1 UTSW 9 50770260 missense possibly damaging 0.74
R4742:Fdxacb1 UTSW 9 50768668 unclassified probably benign
R4789:Fdxacb1 UTSW 9 50770118 missense possibly damaging 0.84
R4935:Fdxacb1 UTSW 9 50771943 missense probably benign 0.00
R5190:Fdxacb1 UTSW 9 50772087 missense possibly damaging 0.78
R5652:Fdxacb1 UTSW 9 50768405 missense probably damaging 1.00
R6130:Fdxacb1 UTSW 9 50772602 nonsense probably null
R7483:Fdxacb1 UTSW 9 50770151 missense possibly damaging 0.89
R7487:Fdxacb1 UTSW 9 50770219 missense possibly damaging 0.88
R7571:Fdxacb1 UTSW 9 50771793 missense probably damaging 0.98
R8069:Fdxacb1 UTSW 9 50768835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGCTGGTGACTAGTGCTG -3'
(R):5'- GGTTTAGGCCCATGGTCTTAC -3'

Sequencing Primer
(F):5'- GGCACTGGTAGACTTTTTATATGC -3'
(R):5'- ATGGTCTTACTTACCTATACCCAGTG -3'
Posted On2020-07-13