Incidental Mutation 'R8201:Cct4'
ID635680
Institutional Source Beutler Lab
Gene Symbol Cct4
Ensembl Gene ENSMUSG00000007739
Gene Namechaperonin containing Tcp1, subunit 4 (delta)
Synonyms2610204B21Rik, A45, T complex protein 1, delta, Cctd, TCP-1 delta
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R8201 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location22990519-23003780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22999115 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 287 (V287E)
Ref Sequence ENSEMBL: ENSMUSP00000133523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020562] [ENSMUST00000173853] [ENSMUST00000173867] [ENSMUST00000174047] [ENSMUST00000174659]
Predicted Effect probably damaging
Transcript: ENSMUST00000020562
AA Change: V257E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020562
Gene: ENSMUSG00000007739
AA Change: V257E

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 61 509 1.6e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173853
SMART Domains Protein: ENSMUSP00000133677
Gene: ENSMUSG00000007739

DomainStartEndE-ValueType
PDB:4B2T|D 1 44 2e-11 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000173867
AA Change: V287E

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133523
Gene: ENSMUSG00000007739
AA Change: V287E

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 44 539 1.9e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174047
SMART Domains Protein: ENSMUSP00000134248
Gene: ENSMUSG00000007739

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 44 93 1.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174659
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The chaperonin containing TCP1 (MIM 186980) complex (CCT), also called the TCP1 ring complex, consists of 2 back-to-back rings, each containing 8 unique but homologous subunits, such as CCT4. CCT assists the folding of newly translated polypeptide substrates through multiple rounds of ATP-driven release and rebinding of partially folded intermediate forms. Substrates of CCT include the cytoskeletal proteins actin (see MIM 102560) and tubulin (see MIM 191130), as well as alpha-transducin (MIM 139330) (Won et al., 1998 [PubMed 9819444]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in Cct4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Cct4 APN 11 22997656 missense possibly damaging 0.63
IGL02076:Cct4 APN 11 23002394 missense probably damaging 1.00
IGL02211:Cct4 APN 11 22993327 intron probably benign
IGL02416:Cct4 APN 11 23002868 missense probably damaging 1.00
R0030:Cct4 UTSW 11 23001357 unclassified probably benign
R0255:Cct4 UTSW 11 22999073 missense probably damaging 1.00
R0494:Cct4 UTSW 11 22996014 missense probably benign
R1244:Cct4 UTSW 11 22996417 missense probably benign 0.02
R1276:Cct4 UTSW 11 23002171 missense probably damaging 1.00
R1401:Cct4 UTSW 11 22994333 missense probably damaging 1.00
R1465:Cct4 UTSW 11 23002922 missense probably damaging 1.00
R1465:Cct4 UTSW 11 23002922 missense probably damaging 1.00
R1809:Cct4 UTSW 11 22997615 missense probably benign 0.00
R3907:Cct4 UTSW 11 23001560 missense probably benign 0.00
R4640:Cct4 UTSW 11 23002297 missense probably benign 0.04
R4785:Cct4 UTSW 11 23002866 missense probably damaging 1.00
R4836:Cct4 UTSW 11 23002898 missense probably benign 0.20
R5846:Cct4 UTSW 11 23001354 unclassified probably benign
R7193:Cct4 UTSW 11 22997111 missense probably benign 0.00
R7214:Cct4 UTSW 11 22990616 unclassified probably benign
R7336:Cct4 UTSW 11 23001564 missense possibly damaging 0.85
R7419:Cct4 UTSW 11 22996420 missense probably benign 0.01
R7725:Cct4 UTSW 11 22990814 missense probably benign
R7951:Cct4 UTSW 11 22990868 missense probably benign 0.38
R8003:Cct4 UTSW 11 22996040 critical splice donor site probably null
R8429:Cct4 UTSW 11 22996030 missense probably damaging 1.00
X0019:Cct4 UTSW 11 22997118 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- CCTATATAACTGGTAGGTGTGGGC -3'
(R):5'- TTAAGAACTGCTGGGTAGAGGC -3'

Sequencing Primer
(F):5'- TGGGCTGGTCTTTCACTTAAC -3'
(R):5'- AGCTGCTTAGAAACTCCAGTTCGG -3'
Posted On2020-07-13