Incidental Mutation 'R8201:Olfr330'
ID635681
Institutional Source Beutler Lab
Gene Symbol Olfr330
Ensembl Gene ENSMUSG00000050818
Gene Nameolfactory receptor 330
SynonymsMOR275-1, GA_x6K02T2NKPP-895420-896349
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R8201 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location58527186-58534836 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to T at 58529039 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 316 (*316R)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134055]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000062869
AA Change: *316R
SMART Domains Protein: ENSMUSP00000063194
Gene: ENSMUSG00000050818
AA Change: *316R

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 1.6e-46 PFAM
Pfam:7TM_GPCR_Srsx 39 309 4.4e-6 PFAM
Pfam:7tm_1 45 294 2.3e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000134055
AA Change: *316R
SMART Domains Protein: ENSMUSP00000145126
Gene: ENSMUSG00000050818
AA Change: *316R

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 1.6e-46 PFAM
Pfam:7TM_GPCR_Srsx 39 309 4.4e-6 PFAM
Pfam:7tm_1 45 294 2.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203550
SMART Domains Protein: ENSMUSP00000145138
Gene: ENSMUSG00000050818

DomainStartEndE-ValueType
Pfam:7tm_4 35 130 1.1e-13 PFAM
Pfam:7TM_GPCR_Srsx 39 130 1.3e-4 PFAM
Pfam:7tm_1 45 130 6.3e-17 PFAM
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in Olfr330
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Olfr330 APN 11 58529396 missense probably benign 0.17
IGL01672:Olfr330 APN 11 58529122 missense probably benign 0.43
IGL01782:Olfr330 APN 11 58529159 missense probably benign 0.03
IGL01998:Olfr330 APN 11 58529577 nonsense probably null
IGL02538:Olfr330 APN 11 58529990 utr 5 prime probably benign
R1670:Olfr330 UTSW 11 58529411 missense probably damaging 1.00
R1727:Olfr330 UTSW 11 58529516 missense possibly damaging 0.51
R1768:Olfr330 UTSW 11 58529776 missense probably damaging 1.00
R1839:Olfr330 UTSW 11 58529373 nonsense probably null
R2129:Olfr330 UTSW 11 58529611 missense probably damaging 1.00
R2135:Olfr330 UTSW 11 58529785 missense probably damaging 1.00
R2425:Olfr330 UTSW 11 58529311 missense probably damaging 1.00
R3753:Olfr330 UTSW 11 58529690 missense probably benign 0.00
R4480:Olfr330 UTSW 11 58529801 missense probably damaging 0.99
R4827:Olfr330 UTSW 11 58529596 missense probably damaging 0.99
R4836:Olfr330 UTSW 11 58529482 missense probably damaging 0.99
R4973:Olfr330 UTSW 11 58529077 missense probably benign
R5128:Olfr330 UTSW 11 58529422 missense probably damaging 0.98
R5288:Olfr330 UTSW 11 58529482 missense probably damaging 0.99
R5326:Olfr330 UTSW 11 58529884 missense probably benign 0.02
R5542:Olfr330 UTSW 11 58529884 missense probably benign 0.02
R5620:Olfr330 UTSW 11 58529731 missense probably damaging 0.99
R6210:Olfr330 UTSW 11 58529264 missense probably damaging 1.00
R7163:Olfr330 UTSW 11 58529168 nonsense probably null
R7886:Olfr330 UTSW 11 58529054 missense probably benign 0.01
RF003:Olfr330 UTSW 11 58529157 frame shift probably null
RF004:Olfr330 UTSW 11 58529157 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACTCCATGAAATGTAACAGTGGCAG -3'
(R):5'- GGTCACCCTCTTCTATGGTG -3'

Sequencing Primer
(F):5'- CATGAAATGTAACAGTGGCAGAATGC -3'
(R):5'- ATGGTGCTGCTATCTATACCTAC -3'
Posted On2020-07-13