Incidental Mutation 'R8201:Ubb'
ID635683
Institutional Source Beutler Lab
Gene Symbol Ubb
Ensembl Gene ENSMUSG00000019505
Gene Nameubiquitin B
SynonymsUbb2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.313) question?
Stock #R8201 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location62551171-62553213 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62552227 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 28 (A28T)
Ref Sequence ENSEMBL: ENSMUSP00000019649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019649] [ENSMUST00000136938]
Predicted Effect probably benign
Transcript: ENSMUST00000019649
AA Change: A28T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000019649
Gene: ENSMUSG00000019505
AA Change: A28T

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
UBQ 77 148 2.14e-36 SMART
UBQ 153 224 2.14e-36 SMART
UBQ 229 300 2.14e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136938
AA Change: A28T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117361
Gene: ENSMUSG00000019505
AA Change: A28T

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
UBQ 77 148 2.14e-36 SMART
UBQ 153 224 2.14e-36 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes ubiquitin, one of the most conserved proteins known. Ubiquitin has a major role in targeting cellular proteins for degradation by the 26S proteosome. It is also involved in the maintenance of chromatin structure, the regulation of gene expression, and the stress response. Ubiquitin is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin moiety fused to an unrelated protein. This gene consists of four direct repeats of the ubiquitin coding sequence with no spacer sequence. Consequently, the protein is expressed as a polyubiquitin precursor with a final amino acid after the last repeat. Pseudogenes of this gene are located on chromosomes 3 and 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Targeted disruption of this gene results in progressive degeneration of hypothalamic neurons accompanied by impaired hypothalamic control of energy balance and adult-onset obesity. Both genders are infertile due to a failure of germ cells to progress through meiosis I and hypogonadism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in Ubb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03302:Ubb APN 11 62552417 missense probably damaging 1.00
BB009:Ubb UTSW 11 62552785 nonsense probably null
BB019:Ubb UTSW 11 62552785 nonsense probably null
R1120:Ubb UTSW 11 62552183 missense possibly damaging 0.94
R6223:Ubb UTSW 11 62552525 missense possibly damaging 0.91
R6753:Ubb UTSW 11 62551527 splice site probably null
R7932:Ubb UTSW 11 62552785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGTTTGAAACCATGACAAAACAGG -3'
(R):5'- TGGCCTTCACGTTCTCGATG -3'

Sequencing Primer
(F):5'- GGTTTTATGTTATGACAAAAAGGGG -3'
(R):5'- ACGTTCTCGATGGTGTCAC -3'
Posted On2020-07-13