Incidental Mutation 'R8201:Olfr382'
ID635684
Institutional Source Beutler Lab
Gene Symbol Olfr382
Ensembl Gene ENSMUSG00000095312
Gene Nameolfactory receptor 382
SynonymsMOR135-31_p, MOR135-14, GA_x6K02T2P1NL-3676608-3675670
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R8201 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location73516259-73517197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73517073 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 42 (N42I)
Ref Sequence ENSEMBL: ENSMUSP00000091575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092921]
Predicted Effect probably damaging
Transcript: ENSMUST00000092921
AA Change: N42I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091575
Gene: ENSMUSG00000095312
AA Change: N42I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.9e-10 PFAM
Pfam:7tm_1 41 290 1.2e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in Olfr382
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Olfr382 APN 11 73516410 missense possibly damaging 0.59
IGL00896:Olfr382 APN 11 73516341 missense probably damaging 1.00
IGL01723:Olfr382 APN 11 73516626 missense probably damaging 1.00
IGL01734:Olfr382 APN 11 73516636 missense probably benign 0.39
IGL02267:Olfr382 APN 11 73516549 missense probably benign 0.44
IGL02681:Olfr382 APN 11 73516530 missense probably benign
IGL03165:Olfr382 APN 11 73516884 nonsense probably null
BB009:Olfr382 UTSW 11 73517157 missense probably damaging 1.00
BB019:Olfr382 UTSW 11 73517157 missense probably damaging 1.00
IGL03134:Olfr382 UTSW 11 73517115 missense probably benign 0.02
R0320:Olfr382 UTSW 11 73516924 missense probably damaging 1.00
R0633:Olfr382 UTSW 11 73516927 missense probably benign 0.23
R0638:Olfr382 UTSW 11 73516924 missense probably damaging 1.00
R0691:Olfr382 UTSW 11 73516844 missense possibly damaging 0.55
R1630:Olfr382 UTSW 11 73516720 missense probably damaging 1.00
R2269:Olfr382 UTSW 11 73516483 missense probably damaging 1.00
R4001:Olfr382 UTSW 11 73516986 missense probably damaging 1.00
R4925:Olfr382 UTSW 11 73517172 missense possibly damaging 0.87
R5707:Olfr382 UTSW 11 73516625 missense probably damaging 1.00
R5911:Olfr382 UTSW 11 73516525 missense probably damaging 1.00
R6225:Olfr382 UTSW 11 73517005 missense probably damaging 0.99
R6251:Olfr382 UTSW 11 73516708 missense probably benign 0.00
R6332:Olfr382 UTSW 11 73517175 missense probably benign 0.00
R7013:Olfr382 UTSW 11 73516421 nonsense probably null
R7196:Olfr382 UTSW 11 73517131 missense probably benign
R7443:Olfr382 UTSW 11 73516848 missense possibly damaging 0.89
R7932:Olfr382 UTSW 11 73517157 missense probably damaging 1.00
R8257:Olfr382 UTSW 11 73516377 missense probably benign 0.28
Z1177:Olfr382 UTSW 11 73517035 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCAGACAGCCAGCATAG -3'
(R):5'- ACTGCAAAATCCACTGTGGTAG -3'

Sequencing Primer
(F):5'- CAGCATAGGAGATGGACGTGTC -3'
(R):5'- CAAAACTGTCATCTCCCAG -3'
Posted On2020-07-13