Incidental Mutation 'R8201:Tmem14c'
ID635685
Institutional Source Beutler Lab
Gene Symbol Tmem14c
Ensembl Gene ENSMUSG00000021361
Gene Nametransmembrane protein 14C
SynonymsHSPC194, 1110021D01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R8201 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location41016292-41022586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 41017710 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 10 (P10S)
Ref Sequence ENSEMBL: ENSMUSP00000021790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021790] [ENSMUST00000046951]
Predicted Effect probably benign
Transcript: ENSMUST00000021790
AA Change: P10S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000021790
Gene: ENSMUSG00000021361
AA Change: P10S

DomainStartEndE-ValueType
Pfam:Tmemb_14 13 104 1.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046951
SMART Domains Protein: ENSMUSP00000040846
Gene: ENSMUSG00000038683

DomainStartEndE-ValueType
WD40 29 68 6.89e-3 SMART
WD40 71 109 1.19e-6 SMART
WD40 112 151 1.59e-7 SMART
Blast:WD40 156 190 4e-10 BLAST
WD40 194 231 3.45e-1 SMART
WD40 234 275 6.89e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit porphyrin accumulation in fetal liver, erythroid maturation arrest, and embryonic lethality due to severe anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in Tmem14c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1892:Tmem14c UTSW 13 41021157 missense possibly damaging 0.94
R5086:Tmem14c UTSW 13 41021122 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TTTGTCCCTGAGGATGATTTAAGC -3'
(R):5'- TCAGGGCCTAAAGCAAACTTG -3'

Sequencing Primer
(F):5'- TCAGAGGACAATTTTCAGGAGTTGC -3'
(R):5'- CTTGAGTCAAGCCATATTAGGTGTC -3'
Posted On2020-07-13