Incidental Mutation 'R8201:Pdlim1'
ID635693
Institutional Source Beutler Lab
Gene Symbol Pdlim1
Ensembl Gene ENSMUSG00000055044
Gene NamePDZ and LIM domain 1 (elfin)
SynonymsCLP36, mClim1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8201 (G1)
Quality Score209.009
Status Not validated
Chromosome19
Chromosomal Location40221173-40271842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40230514 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 224 (D224E)
Ref Sequence ENSEMBL: ENSMUSP00000064545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068439] [ENSMUST00000182432]
Predicted Effect probably benign
Transcript: ENSMUST00000068439
AA Change: D224E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064545
Gene: ENSMUSG00000055044
AA Change: D224E

DomainStartEndE-ValueType
PDZ 12 85 3.23e-18 SMART
Pfam:DUF4749 136 234 4.6e-29 PFAM
LIM 257 308 2.31e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182432
SMART Domains Protein: ENSMUSP00000138383
Gene: ENSMUSG00000055044

DomainStartEndE-ValueType
PDZ 12 85 3.23e-18 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the enigma protein family. The protein contains two protein interacting domains, a PDZ domain at the amino terminal end and one to three LIM domains at the carboxyl terminal. It is a cytoplasmic protein associated with the cytoskeleton. The protein may function as an adapter to bring other LIM-interacting proteins to the cytoskeleton. Pseudogenes associated with this gene are located on chromosomes 3, 14 and 17. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit enhanced platelet response to GPVI agonists and thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in Pdlim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Pdlim1 APN 19 40243466 missense probably benign 0.00
IGL02253:Pdlim1 APN 19 40230530 missense probably damaging 0.99
IGL02312:Pdlim1 APN 19 40223061 missense probably benign 0.00
IGL02584:Pdlim1 APN 19 40243400 splice site probably null
R0391:Pdlim1 UTSW 19 40243573 missense probably damaging 0.99
R1554:Pdlim1 UTSW 19 40223072 missense probably benign 0.19
R1751:Pdlim1 UTSW 19 40251904 splice site probably benign
R1972:Pdlim1 UTSW 19 40223137 missense probably damaging 0.99
R2900:Pdlim1 UTSW 19 40223075 missense probably damaging 1.00
R4709:Pdlim1 UTSW 19 40222736 missense probably benign 0.26
R4803:Pdlim1 UTSW 19 40243448 missense possibly damaging 0.94
R4818:Pdlim1 UTSW 19 40223136 missense probably damaging 0.98
R5360:Pdlim1 UTSW 19 40230549 missense probably damaging 0.99
R5833:Pdlim1 UTSW 19 40230545 missense probably damaging 1.00
R6547:Pdlim1 UTSW 19 40223120 missense probably damaging 0.97
R7699:Pdlim1 UTSW 19 40249658 missense probably damaging 0.99
R7700:Pdlim1 UTSW 19 40249658 missense probably damaging 0.99
R7756:Pdlim1 UTSW 19 40243542 missense probably benign 0.00
R7758:Pdlim1 UTSW 19 40243542 missense probably benign 0.00
R7914:Pdlim1 UTSW 19 40252001 missense probably damaging 0.98
R8331:Pdlim1 UTSW 19 40230551 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- ACAAGCGATCTGTACCTGAG -3'
(R):5'- TTCACCGTTGTCCTGATGGC -3'

Sequencing Primer
(F):5'- GCGATCTGTACCTGAGCCCTC -3'
(R):5'- GGCTTTCCAAATGTTCTTTTTAGCG -3'
Posted On2020-07-13