Incidental Mutation 'R8202:Slamf6'
ID 635696
Institutional Source Beutler Lab
Gene Symbol Slamf6
Ensembl Gene ENSMUSG00000015314
Gene Name SLAM family member 6
Synonyms Ly108, SF2000, KAL1, KAL1b, NTB-A
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_030710.2; MGI:1353620
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R8202 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 171917515-171953170 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 171934219 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 69 (Y69C)
Ref Sequence ENSEMBL: ENSMUSP00000141448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171330] [ENSMUST00000194182] [ENSMUST00000194561] [ENSMUST00000195656]
AlphaFold Q9ET39
Predicted Effect probably benign
Transcript: ENSMUST00000171330
AA Change: Y69C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000130610
Gene: ENSMUSG00000015314
AA Change: Y69C

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 28 37 N/A INTRINSIC
IG 39 142 1.49e-2 SMART
low complexity region 145 161 N/A INTRINSIC
Blast:IG_like 162 226 7e-16 BLAST
transmembrane domain 240 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194182
SMART Domains Protein: ENSMUSP00000142242
Gene: ENSMUSG00000015314

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194561
AA Change: Y69C

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141944
Gene: ENSMUSG00000015314
AA Change: Y69C

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 28 37 N/A INTRINSIC
IG 39 142 1.49e-2 SMART
low complexity region 145 161 N/A INTRINSIC
Blast:IG_like 162 226 5e-16 BLAST
transmembrane domain 240 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195656
AA Change: Y69C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000141448
Gene: ENSMUSG00000015314
AA Change: Y69C

DomainStartEndE-ValueType
low complexity region 28 37 N/A INTRINSIC
IG 39 142 5.9e-5 SMART
low complexity region 145 161 N/A INTRINSIC
Blast:IG_like 162 226 8e-16 BLAST
transmembrane domain 240 262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (50/50)
MGI Phenotype Strain: 3581614
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein, belonging to the CD2 subfamily of the immunoglobulin superfamily. This encoded protein is expressed on Natural killer (NK), T, and B lymphocytes. It undergoes tyrosine phosphorylation and associates with the Src homology 2 domain-containing protein (SH2D1A) as well as with SH2 domain-containing phosphatases (SHPs). It functions as a coreceptor in the process of NK cell activation. It can also mediate inhibitory signals in NK cells from X-linked lymphoproliferative patients. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for one null allele show no overt phenotype. Mice homozygous for another null allele show impaired IL-4 production by CD4+ T cells, reduced inflammatory response to L. mexicana infection, high susceptibility to S. typhimurium infection, and defective neutrophil bactericidal activity. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,100 R36C probably benign Het
B020011L13Rik A T 1: 117,801,144 H127L probably damaging Het
B4galt4 A G 16: 38,767,912 Q306R probably benign Het
Bckdha G A 7: 25,630,313 H431Y probably damaging Het
Cacna1e T A 1: 154,398,449 M2256L probably benign Het
Ccar1 A T 10: 62,771,989 F298L possibly damaging Het
Ceacam3 G A 7: 17,163,028 A640T Het
Cers3 A G 7: 66,786,013 D240G probably damaging Het
Ces1d T C 8: 93,192,867 E99G probably benign Het
Dnah2 A G 11: 69,478,823 V1609A probably benign Het
Fer1l6 T C 15: 58,630,637 F1329S probably damaging Het
Fry A G 5: 150,431,737 Q1825R probably damaging Het
Guf1 C A 5: 69,563,202 A335E possibly damaging Het
Heatr6 C A 11: 83,759,408 T230K possibly damaging Het
Klhl11 G A 11: 100,463,324 S557L probably benign Het
Map10 A G 8: 125,670,908 N347D possibly damaging Het
Myh7 T C 14: 54,990,040 I313V probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nmral1 G A 16: 4,714,584 T131M probably damaging Het
Npr1 T A 3: 90,461,424 Y443F probably benign Het
Ntn4 A G 10: 93,644,903 N163S possibly damaging Het
Nufip1 A G 14: 76,111,164 I78V probably benign Het
Olfr1052 A T 2: 86,298,624 E269D probably benign Het
Olfr645 A G 7: 104,084,991 S30P probably benign Het
Olfr810 T C 10: 129,790,649 *313W probably null Het
Oplah C T 15: 76,302,469 G670D probably benign Het
Pcnx T G 12: 81,895,047 I73S probably benign Het
Pigp A T 16: 94,364,669 N204K probably benign Het
Prelid2 T A 18: 41,932,737 I78F possibly damaging Het
Ptprb A G 10: 116,353,845 Y1516C probably damaging Het
Rab31 T C 17: 65,667,886 E157G probably damaging Het
Rars2 T C 4: 34,656,180 Y445H probably damaging Het
Rnf220 T A 4: 117,489,873 H114L probably damaging Het
Ryr1 A G 7: 29,091,032 W1450R probably benign Het
Smc3 T C 19: 53,628,692 I512T possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
St3gal3 T A 4: 118,107,671 probably benign Het
Tbc1d23 A G 16: 57,191,554 F338L probably damaging Het
Tgs1 G A 4: 3,586,097 A325T probably benign Het
Tmem30a A T 9: 79,774,212 I261K probably damaging Het
Trim3 A T 7: 105,611,425 H662Q possibly damaging Het
Unc13c C T 9: 73,736,562 V1207M probably damaging Het
Vmn1r91 A T 7: 20,101,824 I223F probably damaging Het
Vmn2r33 A T 7: 7,554,154 C516S possibly damaging Het
Vps13c T C 9: 67,944,046 V2321A probably damaging Het
Zan G T 5: 137,389,327 T4874K unknown Het
Zfp677 T C 17: 21,393,273 L43S probably damaging Het
Zfp709 A G 8: 71,888,916 probably null Het
Other mutations in Slamf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Slamf6 APN 1 171917780 missense probably null 0.27
IGL01011:Slamf6 APN 1 171938099 missense probably benign 0.19
P0016:Slamf6 UTSW 1 171936501 missense probably damaging 0.97
R1565:Slamf6 UTSW 1 171934408 missense possibly damaging 0.53
R1763:Slamf6 UTSW 1 171942587 intron probably benign
R1774:Slamf6 UTSW 1 171942587 intron probably benign
R1993:Slamf6 UTSW 1 171934209 missense possibly damaging 0.74
R2155:Slamf6 UTSW 1 171938008 missense probably damaging 0.99
R2328:Slamf6 UTSW 1 171934251 missense probably benign 0.00
R4693:Slamf6 UTSW 1 171934113 nonsense probably null
R5062:Slamf6 UTSW 1 171936533 missense possibly damaging 0.93
R5172:Slamf6 UTSW 1 171936580 missense probably benign 0.01
R5249:Slamf6 UTSW 1 171936682 missense probably damaging 1.00
R5328:Slamf6 UTSW 1 171938095 missense probably benign 0.04
R5771:Slamf6 UTSW 1 171917774 missense probably damaging 0.98
R6339:Slamf6 UTSW 1 171948048 missense probably null 1.00
R6960:Slamf6 UTSW 1 171917753 missense probably damaging 0.98
R7176:Slamf6 UTSW 1 171934291 missense probably benign 0.13
R7400:Slamf6 UTSW 1 171919793 missense unknown
R7535:Slamf6 UTSW 1 171919758 missense unknown
R7629:Slamf6 UTSW 1 171936624 missense probably damaging 0.97
R8934:Slamf6 UTSW 1 171917771 missense possibly damaging 0.76
R9225:Slamf6 UTSW 1 171936703 missense probably benign 0.25
R9338:Slamf6 UTSW 1 171919590 intron probably benign
R9581:Slamf6 UTSW 1 171934330 missense
RF025:Slamf6 UTSW 1 171941582 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- CTGGCCTTCTTCCAAAGAGC -3'
(R):5'- TCTGCGCAGTGTATGATCC -3'

Sequencing Primer
(F):5'- TGGCCTTCTTCCAAAGAGCTTAAAC -3'
(R):5'- ATCCTGTGTCTGCCATGGTAAG -3'
Posted On 2020-07-13