Incidental Mutation 'R8202:Npr1'
ID635698
Institutional Source Beutler Lab
Gene Symbol Npr1
Ensembl Gene ENSMUSG00000027931
Gene Namenatriuretic peptide receptor 1
SynonymsNPRA, guanylyl cyclase-A, GC-A, NPR-A
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R8202 (G1)
Quality Score219.009
Status Validated
Chromosome3
Chromosomal Location90450591-90465866 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90461424 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 443 (Y443F)
Ref Sequence ENSEMBL: ENSMUSP00000029540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029540]
Predicted Effect probably benign
Transcript: ENSMUST00000029540
AA Change: Y443F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029540
Gene: ENSMUSG00000027931
AA Change: Y443F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 50 410 4.7e-54 PFAM
low complexity region 468 488 N/A INTRINSIC
Pfam:Pkinase_Tyr 538 797 1.2e-39 PFAM
Pfam:Pkinase 543 796 8.7e-31 PFAM
CYCc 836 1030 5.04e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124760
SMART Domains Protein: ENSMUSP00000118023
Gene: ENSMUSG00000027931

DomainStartEndE-ValueType
PDB:3A3K|B 2 20 1e-8 PDB
transmembrane domain 25 47 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanylyl cyclases, catalyzing the production of cGMP from GTP, are classified as soluble and membrane forms (Garbers and Lowe, 1994 [PubMed 7982997]). The membrane guanylyl cyclases, often termed guanylyl cyclases A through F, form a family of cell-surface receptors with a similar topographic structure: an extracellular ligand-binding domain, a single membrane-spanning domain, and an intracellular region that contains a protein kinase-like domain and a cyclase catalytic domain. GC-A and GC-B function as receptors for natriuretic peptides; they are also referred to as atrial natriuretic peptide receptor A (NPR1) and type B (NPR2; MIM 108961). Also see NPR3 (MIM 108962), which encodes a protein with only the ligand-binding transmembrane and 37-amino acid cytoplasmic domains. NPR1 is a membrane-bound guanylate cyclase that serves as the receptor for both atrial and brain natriuretic peptides (ANP (MIM 108780) and BNP (MIM 600295), respectively).[supplied by OMIM, May 2009]
PHENOTYPE: Homozygous inactivation of this gene can lead to hypertension, cardiac hypertrophy, lethal vascular events, congestive heart failure in response to volume overload, reduced serum testosterone levels, altered steroidogenesis, and reduced myocardial PMN infiltration and infarct size after I/R injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,100 R36C probably benign Het
B020011L13Rik A T 1: 117,801,144 H127L probably damaging Het
B4galt4 A G 16: 38,767,912 Q306R probably benign Het
Bckdha G A 7: 25,630,313 H431Y probably damaging Het
Cacna1e T A 1: 154,398,449 M2256L probably benign Het
Ccar1 A T 10: 62,771,989 F298L possibly damaging Het
Ceacam3 G A 7: 17,163,028 A640T Het
Cers3 A G 7: 66,786,013 D240G probably damaging Het
Ces1d T C 8: 93,192,867 E99G probably benign Het
Dnah2 A G 11: 69,478,823 V1609A probably benign Het
Fer1l6 T C 15: 58,630,637 F1329S probably damaging Het
Fry A G 5: 150,431,737 Q1825R probably damaging Het
Guf1 C A 5: 69,563,202 A335E possibly damaging Het
Heatr6 C A 11: 83,759,408 T230K possibly damaging Het
Klhl11 G A 11: 100,463,324 S557L probably benign Het
Map10 A G 8: 125,670,908 N347D possibly damaging Het
Myh7 T C 14: 54,990,040 I313V probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nmral1 G A 16: 4,714,584 T131M probably damaging Het
Ntn4 A G 10: 93,644,903 N163S possibly damaging Het
Nufip1 A G 14: 76,111,164 I78V probably benign Het
Olfr1052 A T 2: 86,298,624 E269D probably benign Het
Olfr645 A G 7: 104,084,991 S30P probably benign Het
Olfr810 T C 10: 129,790,649 *313W probably null Het
Oplah C T 15: 76,302,469 G670D probably benign Het
Pcnx T G 12: 81,895,047 I73S probably benign Het
Pigp A T 16: 94,364,669 N204K probably benign Het
Prelid2 T A 18: 41,932,737 I78F possibly damaging Het
Ptprb A G 10: 116,353,845 Y1516C probably damaging Het
Rab31 T C 17: 65,667,886 E157G probably damaging Het
Rars2 T C 4: 34,656,180 Y445H probably damaging Het
Rnf220 T A 4: 117,489,873 H114L probably damaging Het
Ryr1 A G 7: 29,091,032 W1450R probably benign Het
Slamf6 A G 1: 171,934,219 Y69C probably benign Het
Smc3 T C 19: 53,628,692 I512T possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
St3gal3 T A 4: 118,107,671 probably benign Het
Tbc1d23 A G 16: 57,191,554 F338L probably damaging Het
Tgs1 G A 4: 3,586,097 A325T probably benign Het
Tmem30a A T 9: 79,774,212 I261K probably damaging Het
Trim3 A T 7: 105,611,425 H662Q possibly damaging Het
Unc13c C T 9: 73,736,562 V1207M probably damaging Het
Vmn1r91 A T 7: 20,101,824 I223F probably damaging Het
Vmn2r33 A T 7: 7,554,154 C516S possibly damaging Het
Vps13c T C 9: 67,944,046 V2321A probably damaging Het
Zan G T 5: 137,389,327 T4874K unknown Het
Zfp677 T C 17: 21,393,273 L43S probably damaging Het
Zfp709 A G 8: 71,888,916 probably null Het
Other mutations in Npr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Npr1 APN 3 90458362 missense probably damaging 1.00
IGL01432:Npr1 APN 3 90463236 missense possibly damaging 0.85
IGL02106:Npr1 APN 3 90464858 missense probably benign 0.12
IGL03310:Npr1 APN 3 90455991 missense probably benign 0.30
PIT4581001:Npr1 UTSW 3 90462257 missense probably damaging 1.00
R0010:Npr1 UTSW 3 90454832 missense probably damaging 1.00
R0137:Npr1 UTSW 3 90455937 missense probably damaging 1.00
R0384:Npr1 UTSW 3 90465167 missense probably damaging 0.98
R0656:Npr1 UTSW 3 90461369 missense probably benign
R0941:Npr1 UTSW 3 90461409 missense probably benign
R0961:Npr1 UTSW 3 90458721 missense possibly damaging 0.91
R1172:Npr1 UTSW 3 90461382 missense probably benign 0.01
R1747:Npr1 UTSW 3 90458669 missense possibly damaging 0.88
R1763:Npr1 UTSW 3 90459337 missense probably damaging 0.98
R1900:Npr1 UTSW 3 90462188 missense probably damaging 0.98
R3807:Npr1 UTSW 3 90458726 missense probably damaging 0.98
R4017:Npr1 UTSW 3 90456232 missense probably damaging 1.00
R4437:Npr1 UTSW 3 90456286 missense probably damaging 1.00
R4900:Npr1 UTSW 3 90455965 missense possibly damaging 0.77
R5265:Npr1 UTSW 3 90457002 missense probably benign 0.29
R5343:Npr1 UTSW 3 90458208 missense possibly damaging 0.94
R5590:Npr1 UTSW 3 90454842 missense probably damaging 0.99
R5868:Npr1 UTSW 3 90459493 intron probably benign
R6782:Npr1 UTSW 3 90456253 missense probably benign 0.18
R6828:Npr1 UTSW 3 90464813 missense probably benign
R6903:Npr1 UTSW 3 90455145 missense possibly damaging 0.67
R7592:Npr1 UTSW 3 90465016 missense possibly damaging 0.52
R7841:Npr1 UTSW 3 90454868 missense probably damaging 1.00
R8671:Npr1 UTSW 3 90456157 unclassified probably benign
R8683:Npr1 UTSW 3 90455190 missense probably benign 0.38
R8819:Npr1 UTSW 3 90464894 missense probably damaging 0.96
R8820:Npr1 UTSW 3 90464894 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAAGCCAGAACCTCCAGTGTG -3'
(R):5'- TGAGGGTCCTGGAAGTAGAC -3'

Sequencing Primer
(F):5'- AGGAGTCATCTAGTAGTCAGTTGAC -3'
(R):5'- TCCTGGAAGTAGACGGGCAAG -3'
Posted On2020-07-13